pyrimidine

(redirected from Pyrimidine nucleotides)
Also found in: Dictionary, Thesaurus, Encyclopedia.
Related to Pyrimidine nucleotides: Adenine nucleotides

pyrimidine

 [pĭ-rim´ĭ-dēn]
an organic compound that is the fundamental form of the pyrimidine bases, which include cytosine, thymine, and uracil.

py·rim·i·dine (Pyr),

(pī-rim'i-dēn),
1,3-Diazine; a heterocyclic substance, the formal parent of several "bases" present in nucleic acids (uracil, thymine, cytosine) as well as of the barbiturates.

pyrimidine

(pī-rĭm′ĭ-dēn′, pĭ-)
n.
1. A single-ringed, crystalline organic base, C4H4N2, that is the parent compound of a large group of biologically important compounds.
2. Any of a group of substituted derivatives of pyrimidine, including the nitrogen bases uracil, cytosine, and thymine, which are components of nucleic acids. Barbiturates and certain other drugs are also pyrimidines.

py·rim·i·dine

(pir-im'i-dēn)
A heterocyclic substance, the formal parent of several "bases" present in nucleic acids (uracil, thymine, cytosine) as well as of the barbiturates.

pyrimidine

A nitrogenous base compound. Two pyrimidines, cytosine and thymine, are the DNA bases which, with two PURINES, form the genetic code. A third pyrimidine, uracil, takes the place of thymine in RNA.

pyrimidine

one of three types of bases found in NUCLEIC ACIDS, with a single ring structure. DNA contains CYTOSINE and THYMINE, RNA contains cytosine and URACIL. Pyrimidines always pair with PURINES in DNA.
References in periodicals archive ?
Caption: Figure 2: Biosynthetic pathway of pyrimidine nucleotides in H.
PCR primer pairs used in this study * Primer Gene Genome name name Product name coordinates Orientation RdRp ORF 1b Nsp12-pp1ab 15146-15164 Sense primer (RdRp) 15213-15233 Antisense Nsp14 ORF 1b Nsp14-pp1ab 19113-19138 Sense primer (nuclease ExoN 19225-19249 Antisense homolog) Primer Product name length (bpSequence (5' to >3') RdRp 88 TAAGTTTTATGGCGGCTGG# primer TTTAGGATAGTCCCAACCCAT# Nsp14 137 TGTTTGTTTTGGAATTGTAATGTTGA# primer TGGAATGCATGCTTATTAACATACA# Note: 5' propynyl-modified pyrimidine nucleotides are shown in #.
In addition to de novo synthesis, pyrimidine nucleotides can also be synthesized via salvage of the pyrimidine nucleosides uridine and cytidine.