pyrimidine

(redirected from Pyrimidine nucleotides)
Also found in: Dictionary, Thesaurus, Encyclopedia.
Related to Pyrimidine nucleotides: Adenine nucleotides

pyrimidine

 [pĭ-rim´ĭ-dēn]
an organic compound that is the fundamental form of the pyrimidine bases, which include cytosine, thymine, and uracil.
Miller-Keane Encyclopedia and Dictionary of Medicine, Nursing, and Allied Health, Seventh Edition. © 2003 by Saunders, an imprint of Elsevier, Inc. All rights reserved.

py·rim·i·dine (Pyr),

(pī-rim'i-dēn),
1,3-Diazine; a heterocyclic substance, the formal parent of several "bases" present in nucleic acids (uracil, thymine, cytosine) as well as of the barbiturates.
Farlex Partner Medical Dictionary © Farlex 2012

pyrimidine

(pī-rĭm′ĭ-dēn′, pĭ-)
n.
1. A single-ringed, crystalline organic base, C4H4N2, that is the parent compound of a large group of biologically important compounds.
2. Any of a group of substituted derivatives of pyrimidine, including the nitrogen bases uracil, cytosine, and thymine, which are components of nucleic acids. Barbiturates and certain other drugs are also pyrimidines.
The American Heritage® Medical Dictionary Copyright © 2007, 2004 by Houghton Mifflin Company. Published by Houghton Mifflin Company. All rights reserved.

py·rim·i·dine

(pir-im'i-dēn)
A heterocyclic substance, the formal parent of several "bases" present in nucleic acids (uracil, thymine, cytosine) as well as of the barbiturates.
Medical Dictionary for the Health Professions and Nursing © Farlex 2012

pyrimidine

A nitrogenous base compound. Two pyrimidines, cytosine and thymine, are the DNA bases which, with two PURINES, form the genetic code. A third pyrimidine, uracil, takes the place of thymine in RNA.
Collins Dictionary of Medicine © Robert M. Youngson 2004, 2005

pyrimidine

one of three types of bases found in NUCLEIC ACIDS, with a single ring structure. DNA contains CYTOSINE and THYMINE, RNA contains cytosine and URACIL. Pyrimidines always pair with PURINES in DNA.
Collins Dictionary of Biology, 3rd ed. © W. G. Hale, V. A. Saunders, J. P. Margham 2005
References in periodicals archive ?
Caption: Figure 2: Biosynthetic pathway of pyrimidine nucleotides in H.
PCR primer pairs used in this study * Primer Gene Genome name name Product name coordinates Orientation RdRp ORF 1b Nsp12-pp1ab 15146-15164 Sense primer (RdRp) 15213-15233 Antisense Nsp14 ORF 1b Nsp14-pp1ab 19113-19138 Sense primer (nuclease ExoN 19225-19249 Antisense homolog) Primer Product name length (bpSequence (5' to >3') RdRp 88 TAAGTTTTATGGCGGCTGG# primer TTTAGGATAGTCCCAACCCAT# Nsp14 137 TGTTTGTTTTGGAATTGTAATGTTGA# primer TGGAATGCATGCTTATTAACATACA# Note: 5' propynyl-modified pyrimidine nucleotides are shown in #.
In addition to de novo synthesis, pyrimidine nucleotides can also be synthesized via salvage of the pyrimidine nucleosides uridine and cytidine.