
Also found in: Dictionary, Thesaurus, Encyclopedia.


A brand name for IBUPROFEN in a preparation for external use.
Collins Dictionary of Medicine © Robert M. Youngson 2004, 2005
Mentioned in ?
References in periodicals archive ?
Based on the completed study, the obtained results from the projects; Reflex (The Flexible Professional in Knowledge Society), Proflex (Flexible Professional in Knowledge Society), in the project that was implemented in Europe in 2000, known as Tuning project and that included countries from Latin America[8], in the Career After Higher Education project; A European Research Study, that was a reference for the Ecuadoran universities, as well as the IV Encounter of Graduates in 2017, at UNIANDES Ibarra.
Foster's new ProFlex styrene-ethylene butylene-styrene (SEBS) grades provide a high friction surface with vibration damping and insulating properties for overmolding medical instrument handles and grips.
Now, the new Heavy Duty ProFLEX Insoles ($199.99; heat.thermacell.
PCR reactions were conducted on a thermal cycler (Proflex PCR System; Applied Biosystems, Life Technologies, USA).
La PCR se realizo en un termociclador Proflex (Applied Biosystems-Thermo Scientific), utilizando 10 ng de ADN, 2.5 U de Taq polimerasa HotStart (Qiagen, Switzerland), 0.1 [micron]M de cebadores SSU1-F AACCTGGTTGATCCTGCCAGT / SSU2-R TGATCCTTCTGCAGGTTCACCTAC (Medlin et al.
La universidad en Mexico se proyecta como una institucion que proporciona formacion a una gran mayoria de la poblacion a lo largo de toda la vida (PROFLEX, 2010).
Some of the commercially available products are Proflex, Valplast, Sunflex
JUST IN TIME FOR WHAT IS PREDICTED BY THE farmer's almanac to be another long winter, ThermaCELL has introduced ProFLEX Heated Insoles.
Sources said Ashok Khemka in his letter to the Principal Secretary, Agriculture had clarified that the the rates quoted by Proflex Systems were lowest as compared to the rates of The Haryana State Cooperative Supply and Marketing Federation Limited.