Prevotella

(redirected from Prevotella ruminicola)

Prevotella

(prev'ō-tel'ă),
Genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; contains many species previously classified in the genus Bacteroides. P. melaninogenica is the type species.
Farlex Partner Medical Dictionary © Farlex 2012

Pre·vo·tel·la

(prev'ō-tel'ă)
Bacterial genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; includes many species previously classified in the genus Bacteroides.
Medical Dictionary for the Health Professions and Nursing © Farlex 2012

Pre·vo·tel·la

(prev'ō-tel'ă)
Bacterial genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; includes many species previously classified in the genus Bacteroides.
Medical Dictionary for the Dental Professions © Farlex 2012
References in periodicals archive ?
Populations of Fibrobacter succinogenes, Ruminococcus albus, Streptococcus bovis, Prevotella ruminicola, Prevotella albensis, Eubacterium ruminantium, Anaerovibrio lipolytica, Ruminococcus flavefaciens, methanogenic archaea, general protozoa, and general fungi were analyzed using a previously described quantitative PCR method [12-16].
Morrison et al., "Comparative genome analysis of Prevotella ruminicola and Prevotella bryantii: insights into their environmental niche," Microbial Ecology, vol.
Flint, "A xylan hydrolase gene cluster in prevotella ruminicola B14: sequence relationships, synergistic interactions, and oxygen sensitivity of a novel enzyme with exoxylanase and [beta]-(1,4)-xylosidase activities," Applied and Environmental Microbiology, vol.
The high percentage of Prevotella, mainly the species Prevotella ruminicola, Prevotella brevis, Prevotella bryantii and Prevotella albensis (McSweeney & Mackie, 2012), revealed the genus's abundance in the rumen (Bekele et al., 2010; Stevenson & Weimer, 2007).
The glucose toxicity of Prevotella ruminicola: methylglyoxal accumulation and its effect on membrane physiology.
Prevotella ruminicola abundance tended to increase in a linear manner by EOM supplementation (p = 0.080).
In contrast, Prevotella ruminicola, Butyrivibrio proteoclasticus were the two most abundant species associated with cellulases activity in the Korean goat rumen study [4].
Fibrobacter succinogenes, Butyrivibrio fibrisolvens, Ruminococcus albus, Ruminococcus flavefaciens, Prevotella ruminicola, and Actinomyces are the small group of microorganisms used for the gene cloning [16].
Tajima et al [48] designed 12 primer sets specific for culturable ruminal bacterial species that include Fibrobacter succinogenes, Ruminococcus flavefaciens, Ruminococcus albus, Prevotella ruminicola, Prevotella albensis, Prevotella bryantii, Selenomonas ruminantium-Mitsuokella multiacida, Streptococcus bovis, Eubacterium ruminantium, Treponema bryantii, Succinivibrio dextrinosolvens, and Anaerovibrio lipolytica.
Primer used for the real-time polymerase chain reaction Gene name Primer sequence 5'-3' Amplicon size (bp) General bacteria F:CGGCAACGAGCGCAACCC 130 [13] R:CCATTGTAGCACGTGTGTAGCC Ruminococcus F:CGAACGGAGATAATTTGAGTTTACTTAGG 132 [13] flavefaciens R:CGGTCTCTGTATGTTATGAGGTATTACC Butyrivibrio F:ACCGCATAAGCGCACGGA 65 [14] fibrisolvens R:CGGGTCCATCTTGTACCGATAAAT Prevotella ruminicola F:GCGAAAGTCGGATTAATGCTCTATG 78 [14] R:CCCATCCTATAGCGGTAAACCTTTG Lactobacillus spp.