Prevotella

(redirected from Prevotella ruminicola)

Prevotella

(prev'ō-tel'ă),
Genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; contains many species previously classified in the genus Bacteroides. P. melaninogenica is the type species.

Pre·vo·tel·la

(prev'ō-tel'ă)
Bacterial genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; includes many species previously classified in the genus Bacteroides.

Pre·vo·tel·la

(prev'ō-tel'ă)
Bacterial genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; includes many species previously classified in the genus Bacteroides.

Prevotella

a genus of gram negative anaerobic bacteria previously grouped in the genus Bacteroides. Involved in periodontal disease and a cause of dog and cat bite wound infections.

Prevotella melaninogenica
isolated from footrot and foot abscesses of cattle. Previously called Bacteroides melaninogenicus.
Prevotella ruminicola
one of the predominant anaerobic gram negative bacterial species in ruminal contents.
References in periodicals archive ?
Tajima et al [48] designed 12 primer sets specific for culturable ruminal bacterial species that include Fibrobacter succinogenes, Ruminococcus flavefaciens, Ruminococcus albus, Prevotella ruminicola, Prevotella albensis, Prevotella bryantii, Selenomonas ruminantium-Mitsuokella multiacida, Streptococcus bovis, Eubacterium ruminantium, Treponema bryantii, Succinivibrio dextrinosolvens, and Anaerovibrio lipolytica.
The high percentage of Prevotella, mainly the species Prevotella ruminicola, Prevotella brevis, Prevotella bryantii and Prevotella albensis (McSweeney & Mackie, 2012), revealed the genus's abundance in the rumen (Bekele et al.
2] y formato (Lachnospira multiparus, Ruminococcus albus y Ruminococcus flavefaciens), de butirato (Butyrivibrio fibrisolvens, Eubacterium cellulosolvens y Eubacterium rumininantium), de lactato (Lactobacillus ruminis, Lactobacillus vitulinus y Streptococcus bovis) y de amoniaco (Clostridium aminophilum, Clostridium sticklandii y Peptostreptococcus anaerobius) son susceptibles a los ionoforos, mientras que bacterias productoras de succinato y propionato (Anaerovibrio lipolytica, Fibrobacter succinogenes, Megasphaera elsdenii, Prevotella ruminicola, Selenomonas ruminantium, Succinimonas amylolytica y Succinivibrio dextrinosolvens) son resistentes (62).
La actividad amilolitica de los microorganismos ruminales se da principalmente por medio de la accion de enzimas extracelulares, como es el caso de las provenientes de Streptoccocus bovis, Butyrivibrio fibrisolvens, Ruminobacter amylophilus, Prevotella ruminicola y Selenomonas ruminantium, las que en cocultivo manifiestaron su maximo potencial para degradar el almidon (Cotta 1988).
Primer used for the real-time polymerase chain reaction Gene name Primer sequence 5'-3' Amplicon size (bp) General bacteria F:CGGCAACGAGCGCAACCC 130 [13] R:CCATTGTAGCACGTGTGTAGCC Ruminococcus F:CGAACGGAGATAATTTGAGTTTACTTAGG 132 [13] flavefaciens R:CGGTCTCTGTATGTTATGAGGTATTACC Butyrivibrio F:ACCGCATAAGCGCACGGA 65 [14] fibrisolvens R:CGGGTCCATCTTGTACCGATAAAT Prevotella ruminicola F:GCGAAAGTCGGATTAATGCTCTATG 78 [14] R:CCCATCCTATAGCGGTAAACCTTTG Lactobacillus spp.
These include Fibrobacter succinogenes (intestinalis), Ruminococcus albus, Ruminococcus flavefaciens, Butyrivibrio species, Prevotella ruminicola, and Clostridium herbivorans (Varel and Yen, 1997).
89 indicus NCC725 (AY421720) B11 Sporanaerobacteracetigenes DSM13106 85 (GQ461827) B12 Lactobacillus ultunensis DSM 16047 83 (ACGU01000081) B13 Prevotella ruminicola Tc2-24 (AJ009933) 92 B14 Bacterium enrichment culture clone ALO1 92 GLFRUDD03GF2UG (JF686930) B16 Ruminococcus sp.
Prevotella ruminicola 23 bacteria and Butyrivibrio proteoclasticus B316 bacteria were the dominant populations, accounting for 16% and 11%, respectively.
PCR primers for the following taxa have been described previously (Stevenson and Weimer, 2007): Butyrivibrio fibrisolven, Prevotella ruminicola, Megasphaera elsdenii, Selenomonas ruminantium, and Streptococcus bovis.
Reference strains of Succinivibrio dextrinosolvens 22b, Megasphaera elsdenii T81 and Prevotella ruminicola 23 were kindly provided by Dr.
DNA for 16S rRNA 2 Streptococcus bovis 16S ribosomal RNA 3 Prevotella ruminicola isolate L16 16S ribosomal RNA 4 Pseudobutyrivibrio ruminis strain pC-XS7 16S ribosomal RNA 5 Streptococcus bovis 16S ribosomal RNA 6 Prevotella sp.