Prevotella

(redirected from Prevotella ruminicola)

Prevotella

(prev'ō-tel'ă),
Genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; contains many species previously classified in the genus Bacteroides. P. melaninogenica is the type species.

Pre·vo·tel·la

(prev'ō-tel'ă)
Bacterial genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; includes many species previously classified in the genus Bacteroides.

Pre·vo·tel·la

(prev'ō-tel'ă)
Bacterial genus of gram-negative, nonmotile, non-spore-forming, obligately anaerobic, chemoorganotrophic, and pleomorphic rods; includes many species previously classified in the genus Bacteroides.
References in periodicals archive ?
Populations of Fibrobacter succinogenes, Ruminococcus albus, Streptococcus bovis, Prevotella ruminicola, Prevotella albensis, Eubacterium ruminantium, Anaerovibrio lipolytica, Ruminococcus flavefaciens, methanogenic archaea, general protozoa, and general fungi were analyzed using a previously described quantitative PCR method [12-16].
Tambien se menciona que el aumento en las concentraciones de N-N[H.sub.3], se relacionan con la actividad proteolitica de las bacterias ruminales tales como Prevotella ruminicola (Schelling, 1984).
Morrison et al., "Comparative genome analysis of Prevotella ruminicola and Prevotella bryantii: insights into their environmental niche," Microbial Ecology, vol.
Flint, "A xylan hydrolase gene cluster in prevotella ruminicola B14: sequence relationships, synergistic interactions, and oxygen sensitivity of a novel enzyme with exoxylanase and [beta]-(1,4)-xylosidase activities," Applied and Environmental Microbiology, vol.
The high percentage of Prevotella, mainly the species Prevotella ruminicola, Prevotella brevis, Prevotella bryantii and Prevotella albensis (McSweeney & Mackie, 2012), revealed the genus's abundance in the rumen (Bekele et al., 2010; Stevenson & Weimer, 2007).
The glucose toxicity of Prevotella ruminicola: methylglyoxal accumulation and its effect on membrane physiology.
La actividad amilolitica de los microorganismos ruminales se da principalmente por medio de la accion de enzimas extracelulares, como es el caso de las provenientes de Streptoccocus bovis, Butyrivibrio fibrisolvens, Ruminobacter amylophilus, Prevotella ruminicola y Selenomonas ruminantium, las que en cocultivo manifiestaron su maximo potencial para degradar el almidon (Cotta 1988).
Prevotella ruminicola abundance tended to increase in a linear manner by EOM supplementation (p = 0.080).
In contrast, Prevotella ruminicola, Butyrivibrio proteoclasticus were the two most abundant species associated with cellulases activity in the Korean goat rumen study [4].
Fibrobacter succinogenes, Butyrivibrio fibrisolvens, Ruminococcus albus, Ruminococcus flavefaciens, Prevotella ruminicola, and Actinomyces are the small group of microorganisms used for the gene cloning [16].
Tajima et al [48] designed 12 primer sets specific for culturable ruminal bacterial species that include Fibrobacter succinogenes, Ruminococcus flavefaciens, Ruminococcus albus, Prevotella ruminicola, Prevotella albensis, Prevotella bryantii, Selenomonas ruminantium-Mitsuokella multiacida, Streptococcus bovis, Eubacterium ruminantium, Treponema bryantii, Succinivibrio dextrinosolvens, and Anaerovibrio lipolytica.
Primer used for the real-time polymerase chain reaction Gene name Primer sequence 5'-3' Amplicon size (bp) General bacteria F:CGGCAACGAGCGCAACCC 130 [13] R:CCATTGTAGCACGTGTGTAGCC Ruminococcus F:CGAACGGAGATAATTTGAGTTTACTTAGG 132 [13] flavefaciens R:CGGTCTCTGTATGTTATGAGGTATTACC Butyrivibrio F:ACCGCATAAGCGCACGGA 65 [14] fibrisolvens R:CGGGTCCATCTTGTACCGATAAAT Prevotella ruminicola F:GCGAAAGTCGGATTAATGCTCTATG 78 [14] R:CCCATCCTATAGCGGTAAACCTTTG Lactobacillus spp.