DHX16

(redirected from PRP8)

DHX16

A gene on chromosome 6p21.3 that encodes a putative member of the Asp-Glu-Ala-His (DEAH)-motif-containing family of ATP-dependent RNA helicases, which is implicated in pre-mRNA splicing.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
American Red Cross society declared that plasma sample having platelet count two fold or more above the baseline or greater than 1.1 x 106 platelets/ul is labelled as PRP8.
Data were normalized to the internal control PRP8 [14].
Gene Primers Sequence PRP8 Forward TCATGGCTGCGTCTGAAGTA Reverse GGCTCAAACCCTTCCGATAG MET18 Forward TGCTGGAAGTTGTCGTTGC Reverse TCGTTTTTGGAGAGGTGGTC CTT1 Forward GATTCCGTTCTACAAGCCAGAC Reverse GGAGTATGGACATCCCAAGTTTC CTA1 Forward CCAACAGGACAGACCCATTC Reverse TTACCCAAAACGCGGTAGAG
The DNA-quality assay was based on dPCR measurement of amplifiable DNA associated with 4 different amplicons with sizes of 78, 159, 197, and 550 bp, which corresponded to amplicons within the SPINT1 (serine peptidase inhibitor, Kunitz type 1), INTS2 (integrator complex subunit 2), MOCS2 (molybdenum cofactor synthesis 2), and PRP8 [PRP8 premRNA processing factor 8 homolog (S.
Similarly, amplification of the INTS2 (159 bp) sequences yielded a strong fluorescence signal on the FAM (6-carboxyfluorescein) channel because of the higher concentration of the FAM probes specific for the INTS2 gene, whereas amplification of the PRP8 (550 bp) sequences produced a weaker signal on the FAM channel owing to the lower concentration of the FAM probes specific for the PRP8 gene.
Moreover, a triplicate of this experiment revealed that the mean (SD) percentages of droplets observed in each cluster (relative to the total number of droplets) were: 0.58% (0.01%) for the 78-bp SPINT1 cluster, 0.50% (0.03%) for the 159-bp INTS2 cluster, 0.57% (0.01%) for the 197-bp MOCS2 cluster, and 0.53% (0.04%) for the 550-bp PRP8 cluster.