PRDX5

(redirected from PRDX6)

PRDX5

A gene on chromosome 11q13 that encodes peroxiredoxin 5, which is involved in intracellular redox signalling. It reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided in the thioredoxin system.
Mentioned in ?
References in periodicals archive ?
Cosin-Roger et al., "Prdx6 deficiency ameliorates DSS colitis: relevance of compensatory antioxidant mechanisms," Journal of Crohn's & Colitis, vol.
Prdx6 Upregulation by Curcumin Attenuates Ischemic Oxidative Damage via SP1 in Rats after Stroke.
Our study reported similar findings, which demonstrated that using a panel of six TAAs (i.e., BMI-1, PRDX6, NY-ESO-1, p53, HSP70, and MMP-7) could distinguish patients with early ESCC from normal controls, with a sensitivity/specificity of 45%/95% [21].
Moreover, in P1 cells, resveratrol treatment induced an upregulation of PRX1 and a downregulation of PRDX6, which uses glutathione as the physiological reductant, saving the amount of the glutathione for other activities.
Plasma levels of peroxiredoxin isoforms in non-diabeitc healthy control subjects and diabetic patients Non-diabetic Diabetic subjects (n = 25) patients (n = 53) PRDX1 (ng/mL) 16.77 [+ or -] 3.899 21.92 [+ or -] 5.77 * PRDX2 (ng/mL) 20.37 [+ or -] 8.61 36.61 [+ or -] 14.966 * PRDX4 (pg/mL) 2696 [+ or -] 1972 3835 [+ or -] 1454 * PRDX6 (pg/mL) 238 [+ or -] 111 311 [+ or -] 111 * Data are reported as means [+ or -] SD.
Various novel proteins have also been shown to be direct substrates of p38[alpha], including Ahnak, Iws1, Grp78, Pgrmc, Prdx6, and Ranbp2 [71].
Peroxiredoxin 6 (Prdx6) is the sixth mammalian peroxiredoxin isoform and has a single conserved cysteine residue [5].
Primers for rat genes used to verify the array-based gene expression, by rt-PCR Gene name Forward primer 5'-3' Reverse primer 5'-3' Hmger CCATGGCTGGTAGCATAGG GTACAGCTGATGTATAAGTCTTC Cyp17a ACGGTGGGAGACATCTTTGG TGGTCAATCTCCTTTTGGATCTTC Ndufv2 TGACAGCATCCTGGAGAC GAACTTTCCCAGCTCTGAG Dgat1 GAATGCTGAGTCTGTCACC AGCCATCATGGCTGTGAATG Prdx6 GATTCTCAGAGTGGTTGACTC AGCTCTTTGGTGAAGACTCC LSS CAATCCTGACTACCAGAAG CATTGTAGAGTCGCTCTTG FDFT1 TACCTGTCAAGGCTCCGGAAC GCATCCATCATGAGGGTAACTG PEMT CAGCATCATCCTGCTTCTGAAC CCAAAGTAGTCACCTAGAAAGG 2[beta] microglobulin CAACTTCAACTGCTACG CAGAGCTCCATAGAGCTTGA RNA preparation, reverse transcription and real time PCR
Primers for human GAPDH, SOD1, SOD2, CAT, GPX1, CCS, PRDX6, FOXO3, CDKN2A, PAK2, TP53, MAPK14, and JUN were designed by using GenBank database sequences and Primer 3 software [27] (http://bioinfo.ut.ee/primer3-0.4.0/).
A previous report found that the antioxidant protein Prdx6 was increased in the liver of Sig-1R KO animals compared to that of the WT mice [38].
Some detected no antioxidant proteins [47, 48] while others reported them to contain GPX, GST, PRDX1-3, and SOD2 [49]; GPX, PRDX5, TRX, and SOD2 [50]; GST, SOD2, and PRDX6 [51]; and GPX3, PRX1, PRX2, and PRX4 [52].