PCR1

PCR1

polymerase chain reaction. The amplification of a specific DNA sequence, termed target or template sequence, that is present in a complex mixture, by adding two or more short oligonucleotides, also called primers, that are specific for the terminal or outer limits of the template sequence. The template-primers mixture is subjected to repeated cycles of heating to separate (melt) the double-stranded DNA and cooling in the presence of nucleotides and DNA polymerase such that the template sequence is copied at each cycle. Thermostable polymerases such as those obtained from a hot springs bacterium Thermus aquaticus, commonly termed Taq polymerase, are used.
At the end of 20 to 30 such cycles, the amplified target sequence, which may have been present in as few as a single copy in the original mixture, can be readily detected, for example by electrophoresis and ethidium bromide staining in an argarose gel.

multiplex PCR
the detection of more than one template in a mixture by addition of more than one set of oligonucleotide primers.
nested PCR
the primers used in the first round of amplification are either both replaced (nested PCR) or only one is replaced (semi-nested PCR) for the second and subsequent cycles of amplification. Increases the sensitivity and specificity of the PCR.
quantitative PCR
a means for quantifying the amount of template DNA present in the original mixture. Usually achieved by the addition of a known amount of a target sequence that is amplified by the same primer set but can be differentiated, usually by size, at the end of the reaction.
real-time PCR
a method for the detection and quantitation of an amplified PCR product based on incorporation of a fluorescent reporter dye; the fluorescent signal increases in direct proportion to the amount of PCR product produced and is monitored at each cycle, 'in real time', such that the time point at which the first significant increase in the amount of PCR product correlates with the initial amount of target template.
reverse-transcriptase PCR (RT-PCR)
a reaction applied when the target sequence is RNA, such as viral RNA or messenger RNA. Reverse transcriptase that copies DNA from an RNA template is present in the first round.
References in periodicals archive ?
We used DNA samples from tumors harboring 4 known FGFR3 mutations (R248C, S249C, G372C, and Y375C) to set up the PCR conditions so that only mutated DNA and not wild-type DNA was amplified in 2 different PCRs: PCR1 for detection of the R248C and G372C mutations, and PCR2 for S249C and Y375C.
3 [micro]M primers PCR1 to PCR4 in different combinations (PCR1, tatggcgcgcCGCAC CGDGGATCCTAGGC; PCR2, tatggcgcgcCGCAC CGAGGATCCTAGGCATT; PCR3, tatggcgcgcCG CACCGGGGATCCTAGGCAAT; PCR4, tatggcgc gcCGCACCGGGGATCCTAGGCTT; PCR5, tatgg cgcgcCGCACCGDGGATCCTAGGCWWT; heterologous sequences to facilitate cloning via AscI in lower case) was overlaid with 2 drops of oil and heated to 55 [degrees] C.
The 3'-end of primer PCR1 exactly corresponded to that of the RT primer, but primers PCR2 to PCR5 contained additional two or three nucleotides at their 3'-end.
Researchers use the Fluidigm chip's ability to count individual molecules -- using digital PCR1 and the company's Digital Array chip -- to set the exact parameters for the sequencing step.
The amplification conditions for PCR1 were 1X Buffer 11 (Perkin-Elmer), 1.
The cycling protocols for PCR1 were as follows: 1 cycle at 95[degrees]C for 9 min; 10 cycles at 95[degrees]C for 30 s, 72[degrees]C for 30 s, and 72[degrees]C for 45 s;10 cycles at 95[degrees]C for 30 s, 72[degrees]C ramped to 67[degrees]C at 0.
The fragments amplified in PCR1 were analyzed with probes specific for [DELTA]F508, [G.