Also found in: Acronyms.


Farlex Partner Medical Dictionary © Farlex 2012
References in periodicals archive ?
PCR amplification indicated that 14 tick pools were positive with rrs, gltA, and ompB (B1-B4) primers and further positively amplified by PCR with ompA primers.
Positive samples in nested-PCR were used for outer membrane protein A (ompA) gene sequencing with a 1050 bp DNA PCR product using oligonucleotide CTU(5'-ATG AAA AAA CTC TTG AAA TCG G-3')/CTL(5'-CAA GAT TTT CTA GAY TTC ATY TTG TT-3') primers.
OMPA provides competitive-cost wholesale energy supply (6.90 cents/kWh in 2017) to 42 participating trusts located predominantly in rural Oklahoma, pursuant to long-term, take-and-pay PSCs that underpin its credit quality.
Molecular characteristics of the ompA gene of serotype B Chlamydia trachomatis in Qinghai Tibetan primary school students.
coli adherence factor K88 and CS31A gene, while afaE-8 was negative; meanwhile 10(12.35%), 16(19.75%) and 38(46.91%) isolates were positive for toxins estA, estB and EAST1 genes, respectively, while Stxl and Stx2 were test negative; 12(14.81%), 44(54.32%) and 56(69.14%) isolates were positive for pathogenicity island eaeA, irp2 and ETT2 genes, respectively; while 73 (90.12%) isolates were positive for outer membrane protein ompA genes (Fig.
Hop et al., "Immune modulation of recombinant OmpA against Brucella abortus 544 infection in mice," Journal of Microbiology and Biotechnology, vol.
1 Bla P62593 2 DsbA P0AEG4 3 Endo-1, Q59256 4-P-xylanase 4 gIII P03661 5 LamB P02943 6 L- P00805 Asparaginase II 7 LivK P04816 8 LPP P69776 9 LTB P13811 10 MalE P0AEX9 11 MglB P0AEE5 12 npr P06832 13 OmpA P0A910 14 OmpC P06996 15 OmpF P02931 16 OmpT P09169 17 Pac P06875 18 PelB Q6CZT3 19 PhoA P00634 20 PhoE P02932 21 sfmC P77249 22 ST-IA/ST-P P01559 23 STII P22542 24 TolB P0A855 25 TorA P33225 26 TorT P38683 Source Amino acid sequence 1 Escherichia coli MSIQHFRVALIPFFAAF CLPVFA 2 Escherichia coli K-12 MKKIWLALAGLVLAFSASA 3 Bacillus sp.
Our results demonstrated that of all the OMPs in the isolates collected from the hospitalized and OPD patients, OmpA and OmpC were the most prevalent proteins in the outer membrane of the studied uropathogenic E.
Sequences of primers used for amplification of rickettsial ompA. Fragment Primer name Primer sequence size Primer source Rr190.70p 5' ATGGCGAATATTTCTCCAAAA 532 Regnery, 1991 Rr190.602n 5' AGTGCAGCATTCGCTCCCCCT Regnery, 1991 NestFor 5' TAGCGGGGCACTCGGTGTTG 240 This study NestRev 5' AGACCTACGGGACTAGTACC This study TABLE 2.