Nocardia


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to Nocardia: actinomyces, Nocardia asteroides

Nocardia

 [no-kahr´de-ah]
a genus of gram-negative, aerobic, spore-forming bacteria, including N. asteroi´des, a species of opportunistic pathogens that cause nocardiosis and actinomycotic mycetoma.

Nocardia

(nō-kar'dē-ă),
A genus of aerobic actinomycetes (family Nocardiaceae, order Actinomycetales), higher bacteria, containing weakly acid-fast, slender rods or filaments, frequently swollen and occasionally branched, forming a mycelium. Coccus or bacillary forms are produced by these organisms, which are mainly saprophytic but may be a cause of mycetoma or nocardiosis.
[E. Nocard]

no·car·di·a

, pl.

no·car·di·ae

(nō-kar'dē-ă, nō-kar'dē-ē),
A vernacular term used to refer to any member of the genus Nocardia.

No·car·di·a

(nō-kahr'dē-ă)
A genus of aerobic actinomycetes (family Nocardiaceae, order Actinomycetales), higher bacteria, containing weakly acid-fast, slender rods or filaments, frequently swollen and occasionally branched, forming a mycelium. Coccus or bacillary forms are produced by these organisms, which are mainly saprophytic but may be a cause of mycetoma or nocardiosis.

no·car·di·a

, pl. nocardiae (nō-kahr'dē-ă, -ē)
A vernacular term used to refer to any member of the genus Nocardia.

Nocard,

Edmund I.E., French veterinarian, 1850-1903.
Nocardia - a genus of aerobic nonmotile actinomycetes (family Nocardiaceae, order Actinomycetales), transitional between bacteria and fungi, which are mainly saprophytic but may produce disease in human beings and other animals.
Nocardia brasiliensis
Nocardia dacryoliths - white pseudoconcretions, composed of masses of Nocardia species found in the lacrimal canaliculi. Synonym(s): Desmarres dacryoliths
Nocardiasis bovine farcy
Nocardiaceae - a family of acid-fast, gram-positive, aerobic bacteria (order Actinomycetales) that includes the genus Nocardia.
nocardiosis - a pulmonary or brain infection that is caused by Nocadia asteroides.
Preisz-Nocard bacillus - see under Preisz

No·car·di·a

(nō-kahr'dē-ă)
A genus of aerobic, higher bacteria, containing weakly acid-fast, slender rods or filaments, frequently swollen and occasionally branched, forming a mycelium; mainly saprophytic but may cause mycetoma or nocardiosis.
References in periodicals archive ?
5 2-6d SR 6 2-7a Nocardia cerradoensis 7 2-8d SR 8 2-9b SR 9 2-10b Bacillus megaterium 10 2-10bp Burkholderia phytofirmans 11 C+ 12 C- Valores promedio de tres repeticiones y el error estandar ([+ o -]), C-: Control negativo usado, sin cultivo bacteriano, C+: control positivo Sinorhizobium meliloti 1021 (Sm).
Primers NG1 (5'CTCGTCCAGCGCCGCTTCGG3') and NG2 (5'CCTGCGAGCGTAGGCGGTGG3') were used to amplify a Nocardia genus-specific 590 bp fragment of 16S rRNA.
Nocardia pseudobrasiliensis is an uncommon pathogen phenotypically similar to N.
Rates of Nocardia infection after lung transplantation range from to 1.8% to 2.1% [5, 6].
Biocontrol potential of different genera of Actinobacteria against fungal plant Pathogens Genera Number of strains Number of strains inhibited MP inhibited SR Streptomyces (26 no's) 20 20 Nocardia (12 no's) 7 7 Saccharoployspora (2 no's) 2 2 Micromonospora (1 no) 1 1 Genera Number of strains Number of strains inhibited RS inhibited FO Streptomyces (26 no's) 18 2 Nocardia (12 no's) 6 0 Saccharoployspora (2 no's) 1 0 Micromonospora (1 no) 1 0 * MP: Macrophomina phaseolina, SR: Sclerotium rolfsii, RS: Rhizoctonia solani, FO: Fusarium oxysporum Table 3.
Twelve bacterial genera namely Acaligens, Azotobacter, Bacillus, Bartonella, Corynebacterium, Klebsiella, Listeria, Nitrsomonas, Nocardia, Paeudomonas, Salmonella and Streptomycete were isolated from ejecta of P.
Based on the 16S rRNA gene sequence analysis, the most abundant Actinobacteria genera were Streptomyces (86.84%), followed by Nocardiopsis (4.93%), Brevibacterium (1.64%), Microbacterium (1.64%), Tsukamurella (1.64%), Arthrobacter (0.66%), Brachybacterium (0.66%), Nocardia (0.66%), Rhodococcus (0.66%), Kocuria (0.33%), Nocardioides (0.33%), and Pseudonocardia (0.33%).
Uncommon bacterial infections that can cause cavitary lesions are Actinomyces, Nocardia, Burkholderia pseudomallei, Rhodococcus equi, and nontuberculous and tuberculous mycobacteria.
(3) Organisms which have been reported for broncholith-associated pneumonia include fungi, Nocardia, Histoplasma, and Actinomyces, with actinomycosis appearing in the largest number of case reports.
Nocardiae (genus Nocardia) are aerobic, Gram-positive, mycolic acid-containing actinomycetes and characteristically form acid-alcohol-fast branching filaments.
marinum, other nontuberculous mycobacteria, Nocardia, Leishmania, and Tularemia [5].