NR3C1


Also found in: Dictionary, Financial, Encyclopedia.

NR3C1

A gene on chromosome 5q31.3 that encodes a glucocorticoid receptor, which acts as either a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, or as a regulator of other transcription factors.

Molecular pathology
NR3C1 mutation are associated with generalised glucocorticoid resistance.
References in periodicals archive ?
NR3C1 encodes a protein expressed in neurons that responds to hormones called glucocorticoids.
An NR3C1 diallelic single nucleotide polymorphism, Bcl-1, has been reported to distinguish individuals with the highest GC sensitivity.
The distribution of the NR3C1 Bcl-1 polymorphism in the intron 2 polymorphism were evaluated in RA patients and healthy control populations by using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.
Genotype frequencies of the NR3C1 Bcl-1 polymorphism did not differ between the patients with RA and the controls (table 2).
Frequency of Bcl-1 genotypes in control and rheumatoid arthritis cases NR3C1 gene Rheumatoid arthritis Healthy OR (n=65) control (n=70) n % n % BCL-1 polymorphism Genotype CC 35 53.
1 CYP4B1 TGACCATGTGCATCAAAGGAG Other drug-metabolizing enzymes NM_000120 EPHX1 TGATGAGGGAGAGCGGGCTAC NM_002021 FMO1 GCTGTTCGAGTCCTGAAAGG NM_006894 FMO3 GGCAGGGCTAGCATTTACAA NM_001461 FMO5 CTCTCAGTTTCATATTGCCCAG NM_000846 GSTA2 GCCCAAGCTCCACTACTTCA NM_000561 GSTM1 TTCCCAATCTGCCCTACTTG XM_040116 GSTP1 ACCTCCGCTGCAAATACATC XM_003547 UGT2A1 TTGGCCAATGGAAGGTAGTC Nuclear transcription factors NM_001621 AHR CTGCCTTTCCCACAAGATGT NM_005122 NR1I3 GTCATGGCCAGTAGGGAAGA M10901 NR3C1 GCTCTGGGGTGGAGATCATA U22662 NR1H3 TCAACCCCATCTTCGAGTTC AF061056 NR1I2 TTGTTCGGCATCACAGGTAG Housekeeping gene NM_021130 Cyclophilin CTTGCCATTCCTGGACCCAA Product Accession no.