NR2F2

NR2F2

A gene on chromosome 15q26 that encodes a member of the steroid thyroid hormone superfamily of nuclear receptors, which is a ligand-activated transcription factor involved in regulating a wide range of genes.
Mentioned in ?
References in periodicals archive ?
Rare variants in NR2F2 cause congenital heart defects in humans.
The binding of the 3,-UTR of nuclear receptor subfamily 2 (group F, member 2) (NR2F2) to miRNA-382 was subsequently confirmed by luciferase report assay [40].
In addition, we observed downregulation of osteoblast inhibitory genes NR2F2, DKK1, and Sost in IL-27-treated osteoblast/osteocytes (Figure 2(a), right plot), suggesting that IL-27 may enable osteoblasts to escape inhibitory signals from these pathways.
miRNA Expression Cellular process level miR-25b Overexpression Promotes proliferation and differentiation of NSPCs miR-17-92 Overexpression Increase axonal outgrowth miR-92a Upregulation/ Inhibits the transition from radial overexpression glial cells to intermediate progenitors miR-184 Upregulation Inhibits differentiation and promotes proliferation of NSPCs miR-302 Upregulation Block neural progenitor induction miR-96 Upregulation Block neural progenitor induction miRNA Molecular target Reference miR-25b IGF signaling [154] miR-17-92 PTEN [123] miR-92a Tbr2 [155] miR-184 Numbl [156] miR-302 BMP/TGF[beta], NR2F2 [157] miR-96 PAX6 [158] TABLE 4: miRNA associated with neurogenesis modified after different stimulus.
Gene symbol Forward/ Base (gene bank) reverse pairs 18sRNA CGGCTACCATCCAAGGAA 186 GCTGGAATTACCGCGGCT RUNX1 (NM.001754) GTGGTCAGCAGGCAGGACGAA 678 TGGCGACTTGCGGTGGGTTTG JUN (NM.002228) CGCTGCCTCCAAGTGCCGAA 673 GCCTCGCTCTCACAAACCTCCC NR2F2 (NM.021005) CGAGTGCGTGGTGTGCGGAG 766 GGCTACATCAGAGAGACCACAGGCA GATA6 (NM005257) CGGCGGCTTGGATTGTCCTGTG 663 GCCCTTCCCTTCCATCTTCTCTCA PCNA (NM J82649) GCAGGCGTAGCAGAGTGGTCG 482 AACTTTCTCCTGGTTTGGTGCTTCA SMAD2 (NM005901) GTTCCGCCTCCAATCGCCCA 209 TGGCGGCGTGAATGGCAAGA RB1 (NM.000321) GCAACCTCAGCCTTCCAGACCC 705 GCTTCCTTCAGCACTTCTTTTGAGC NOTCH2 (NM024408) TGGCTTTGCTGGGGAGCGTTG 654 CAGGGAAGTGGGGAGGAGCAGT MSX2 (NM.002449) AGATGGAGCGGCGTGGATGC 660 GGCTTGGTGCCTCCGCCTAC TABLE 2: Top physiological system development and function in SHED and ASC.
At the beginning of implantation window period in human, the expression of chicken ovalbumin upstream promoter transcription factor (COUP-TF) II, which is encoded by NR2F2 gene [24] was increased in uterine stroma under the influence of progesterone [25].