Mycoplasma hominis

Also found in: Dictionary, Thesaurus, Wikipedia.


a genus of highly pleomorphic, gram-negative, aerobic or facultatively anaerobic bacteria that lack cell walls, including the pleuropneumonia-like organisms and other species.
Mycoplasma ho´minis a species found associated with nongonococcal urethritis and mild pharyngitis.
Mycoplasma pneumo´niae a cause of primary atypical pneumonia; called also Eaton agent.
Miller-Keane Encyclopedia and Dictionary of Medicine, Nursing, and Allied Health, Seventh Edition. © 2003 by Saunders, an imprint of Elsevier, Inc. All rights reserved.

My·co·plas·ma hom·i·nis

a bacterial species that is the causative agent of pelvic inflammatory disease and other genitourinary tract infections; can also cause chorioamnionitis and postpartum fever; can be an oropharyngeal commensal and has caused nosocomial wound infections.
Farlex Partner Medical Dictionary © Farlex 2012

My·co·plas·ma hom·i·nis

(mī'kō-plaz'mă hom'i-nis)
A bacterial species that is an agent of pelvic inflammatory disease and other genitourinary tract infections; can also cause chorioamnionitis and postpartum fever.
Medical Dictionary for the Health Professions and Nursing © Farlex 2012

Mycoplasma hominis

A species of Mycoplasma that can cause genital tract infections (nongonococcal urethritis).
See also: Mycoplasma
Medical Dictionary, © 2009 Farlex and Partners
References in periodicals archive ?
Pathogens Detection by PCR and MYCO WELL D-ONE * M+/PCR+ M+/PCR- M-/PCR+ Gardnerella vaginalis 33 2 4 Trichomonas vaginalis 3 -- -- Mycoplasma hominis 5 2 2 Mycoplasma genitalium 1 -- 1 +Mycoplasma spp.
Prevalence and antimicrobial susceptibility of Ureaplasma urealyticum and Mycoplasma hominis in a population of Italian and immigrant outpatients.
The presence of genes alr, goiB, and goiC in Mycoplasma hominis isolated from protozoan strains was assessed by specific PCR as described by Allen-Daniels et al.
Several days after discharge, 16S ribosome testing revealed Mycoplasma hominis RNA within the peritoneal fluid.
The results of detection of genital mycoplasma revealed that only 3 (16.7%) of expressed prostate secretion samples give positive results for both Ureaplasma urealyticum and Mycoplasma hominis while 10 (45.5%) urethral swab were positive for both.
There are three species of Mollicutes worth mentioning in the context of urogenital tract infections: Mycoplasma hominis, Ureaplasma urealyticum, and M.
Table 1: Nucleotide Sequences of Primers and Probes Used Analysis, Organism, Target or DNA Sequence(5'-3') Length and Primer or Probe (bp) Mycoplasma hominis RNAH1 CAATGGTAATGCCGGATACGC 334bp Mycoplasma hominis RNAH2 GGTCCGTCAGTCTGCAAT 334bp Mycoplasma genitalium MG16-45 F TACATGCAGTCGATCGGAAGTAGC 282bp Mycoplasma genitalium MG16-447R 282bp AAACTCCGCCATTGCCTGCCTGCTAG Ureaplasma urealyticum U4 primerACGACGTCCTAAGCACT 429bp Ureaplasma urealyticum U5 primer CAATCTGCTCGTGGTATTAC 429bp
Reiter's syndrome is the most common reactive arthritis among younger men caused by microorganisms such as urogenital form of Chlamydia, rarely by ureaplasma and Mycoplasma hominis and enterocolitic forms of Shigella (S.
Renaudin, "Alterations in topoisomerase IV and DNA gyrase in quinolone-resistant mutants of Mycoplasma hominis obtained in vitro," Antimicrobial Agents and Chemotherapy, vol.
la Vignera et al., "Prevalence of Urea-plasma urealyticum and Mycoplasma hominis infection in unselected infertile men," Journal of Chemotherapy, vol.

Full browser ?