Int
Migr Rev 47(4):874-909, PMID: 25473143, https://doi.org/10.
Cell Adh
Migr 2016; 10: 652-674, doi: 10.1080/19336918.2016.1197478.
Where, RER is real effective exchange rate (18) and
Migr stands for number of migrants from the home country.
Dans la vidAaAaAeA@o filmAaAaAeA@e par une camAaAaAeA@ra cachAaAaAeA@e, on un passeur en train de vendre AaAaAeA la sauvette et aux enchAaAaAeA?res des
migr pour la bagatelle de 400 AaAaAeA 750 dollars.
On resistance inside and outside of sites of immigration detention, see Alessandro Spena, Letter to the Editor, "Resisting Immigration Detention" (2016) 18:2 Eur J
Migr & L 201; Rachel Kronick et al, "International Solidarity to End Immigration Detention" (2017) 389:10068 Lancet 501.
The primer pair used was MIGF: 5'TTGATTACGTCCCTGCCCTTT3' and
MIGR: 5'TTTCACTCGCCGTTACTAACG3' (Vrain et al., 1992) obtained from Xcelris Genomics Lab Limited.
(39.) OECD, INTERNATIONAL MIGRATION OUTLOOK 2013 (OECD, 2013), http://www.oecdilibrary.org/social-issues-migration -health/international-migration-outlook-2013
migr outlook-2013en.
Clover, who spoke at the Carnegie Endownment for International Peace, traced the origins of the "new nationalism" to Russian
migr writers in the wake of the Bolshevik seizure of power, and analyzed the writings of their successors, including Alexander Dugin.
statesAaAeAeA accepting asylum-seekersAaAeAeA and
migr has ragedAaAeAeA since President Barack Obama (http://www.nytimes.com/2015/09/11/world/middleeast/obama-directs-administration-to-accept-10000-syrian-refugees.html?_r= announced his intention to welcome 10,000 Syrian refugees.
(77.) Helen O'Nions, "Roma Expulsions and Discrimination: The Elephant in Brussels" (2011) 13:4 Eur J
Migr & L 361 ("[discrimination becomes difficult to prove as the Roma applicant has no hypothetical comparator due to such profound structural inequities" at 378) [O'Nions, "Roma Expulsions and Discrimination"].