CXCR3

(redirected from MigR)

CXCR3

A gene on chromosome 2q21 that encodes a seven-transmembrane G protein-coupled receptor belonging to the CXC chemokine receptor family, which selectively binds CXCL9, CXCL10 and CXCL11; it induces cellular responses involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
Int Migr Rev 47(4):874-909, PMID: 25473143, https://doi.org/10.
Where, RER is real effective exchange rate (18) and Migr stands for number of migrants from the home country.
Dans la vidAaAaAeA@o filmAaAaAeA@e par une camAaAaAeA@ra cachAaAaAeA@e, on un passeur en train de vendre AaAaAeA la sauvette et aux enchAaAaAeA?res des migr pour la bagatelle de 400 AaAaAeA 750 dollars.
On resistance inside and outside of sites of immigration detention, see Alessandro Spena, Letter to the Editor, "Resisting Immigration Detention" (2016) 18:2 Eur J Migr & L 201; Rachel Kronick et al, "International Solidarity to End Immigration Detention" (2017) 389:10068 Lancet 501.
The primer pair used was MIGF: 5'TTGATTACGTCCCTGCCCTTT3' and MIGR: 5'TTTCACTCGCCGTTACTAACG3' (Vrain et al., 1992) obtained from Xcelris Genomics Lab Limited.
(39.) OECD, INTERNATIONAL MIGRATION OUTLOOK 2013 (OECD, 2013), http://www.oecdilibrary.org/social-issues-migration -health/international-migration-outlook-2013 migr outlook-2013en.
Clover, who spoke at the Carnegie Endownment for International Peace, traced the origins of the "new nationalism" to Russian migr writers in the wake of the Bolshevik seizure of power, and analyzed the writings of their successors, including Alexander Dugin.
statesAaAeAeA accepting asylum-seekersAaAeAeA and migr has ragedAaAeAeA since President Barack Obama (http://www.nytimes.com/2015/09/11/world/middleeast/obama-directs-administration-to-accept-10000-syrian-refugees.html?_r= announced his intention to welcome 10,000 Syrian refugees.
(77.) Helen O'Nions, "Roma Expulsions and Discrimination: The Elephant in Brussels" (2011) 13:4 Eur J Migr & L 361 ("[discrimination becomes difficult to prove as the Roma applicant has no hypothetical comparator due to such profound structural inequities" at 378) [O'Nions, "Roma Expulsions and Discrimination"].