MEF2A

(redirected from Mef2)
Also found in: Acronyms, Wikipedia.

MEF2A

A gene on chromosome 15q26 that encodes a DNA-binding transcription factor, which activates an array of muscle-specific, growth factor-induced and stress-induced genes. It plays a role in muscle development, neuronal differentiation, cell growth control and apoptosis.

Molecular pathology
MEF2A mutations have been linked to autosomal dominant coronary artery disease 1 with myocardial infarction.
References in periodicals archive ?
The expression of Mb, CaN, NFATcl, and MEF2 mRNA was upregulated in skeletal muscle across all ages, but PGC-1[alpha] mRNA expression showed the opposite trend in this study.
In summary, this study found that different ages at slaughter could influence porcine meat color, myoglobin content (OMb, DMb, and MMb), enzyme activities (LDH and MDH), and genes associated with oxidative potential in skeletal muscle (Mb, CaN, NFATcl, MEF2, and PGC-1[alpha]).
1 F: ACCTGAAGAAGCACGGCAAC 59 R: ACCAAAGTCCCCAGGATGCTTG MEF2 NM_001097421.
The fact that coronary artery abnormalities have not been seen in heterozygous or homozygous MEF2A null mice supports the notion that the mutation in this affected pedigree creates a dominant negative version of the MEF2A protein that perturbs the activities of other MEF2 proteins, which might partially substitute for the lack of MEF2A in MEF2A null mice.
Identification of MEF2A mutations in families and patients with CAD and MI clearly links the MEF2 signaling pathway to an important human disease.
MiR-1 could strongly enhance myogenesis by increasing expression of myogenic markers, including myogenin, myosin heavy chain, MyoD, MEF2, and skeletal a-actin (Chen et al.
Phosphoinositide 3-kinase induces the transcriptional activity of MEF2 proteins during muscle differentiation.