MYH9


Also found in: Dictionary.

MYH9

A gene on chromosome 22q13.1, which encodes a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain. It is
involved in cytokinesis, cell motility, maintaining cell shape and specialised functions, such as secretion and capping.

Molecular pathology
MYH9 mutations are linked to non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.
Mentioned in ?
References in periodicals archive ?
The primers utilized in this study are shown as follows: Myh9 F: ACAATGGAGGCCATGAGAAT, Myh9 R: GAGATGACCCGCAGCAAG, Myh10 F: GGAGGACACCCTAGACACCA, and Myh10 R: CCACTTCCTGCTCACGTTTT
Garellek et al., "Glomerular MYH9 expression is reduced by HIV-1," Aids, vol.
Daeihagh et al., "Coincident idiopathic focal segmental glomerulosclerosis collapsing variant and diabetic nephropathy in an african american homozygous for MYH9 risk variants," Human Pathology, vol.
This variable highly correlated with the ARGs PPIA (0.92), CUL5 (0.51), TSG101 (0.48), IDH1 (0.17), and PECI (0.15), but not GML (-0.16), APOBEC3G (-0.17), MYH9 (-0.17), IL4 (-0.18), TLR9 (-0.18), CXCR1 (-0.25), HLA-C (-0.26), NCOR2 (-0.28), DC-SIGN (-0.29), and TLR8 (-0.36).
Doron Behar of Rambam Medical Center, discovered highly informative DNA markers in the MYH9 gene.
Velocardiofacial syndrome, MYH9 gene-related disorders and Jacobsen syndrome (JBS) are well-known inherited syndromes of thrombocytopenias, in which platelets are increased in size and affected probands have unique phenotypic expressions such as cardiovascular, renal, skeletal and gonadal anomalies [2].
A mutation in the MYH9 gene that encodes for non-muscle myosin heavy chain, a cytoskeletal protein in platelets, may be responsible for the abnormal platelet diameter.
TGF-[beta] and a specific TGF-[beta] inhibitor regulate pericentrin B and MYH9 in glioma cell lines
MYH9 and APOL1 gene polymorphisms and the risk of CKD in patients with lupus nephritis from an admixture population.
Lu et al., "Differential effects of MYH9 and APOL1 risk variants on FRMD3 association with diabetic ESRD in African Americans," PLoS Genetics, vol.
Mutations in the MYH9 gene encoding for the nonmuscle myosin heavy chain IIA result in a spectrum of macrothrombocytopenia disorders with neutrophil inclusions referred to as MYH9 disorders.