MYF5


Also found in: Acronyms, Wikipedia.

MYF5

A gene on chromosome 12q21 that encodes a protein involved in muscle differentiation and induces fibroblasts to differentiate into myoblasts.
References in periodicals archive ?
During embryonic development, Pax3(+)/Pax7(+) positive cells continually generate fetal myoblasts, which can be identified by their expression of Myf5 (the earliest marker of the myogenic lineage).
Proliferating satellite cell-derived from all the three muscle depots expressed several myoblast markers, such as MyoD, Myf5, myogenin and desmin, indicating that isolated satellite cells are already committed to the myogenic cell lineage (Grounds et al., 1992; Smith et al., 1994; Cornelison and Wold, 1997; Seale et al., 2000; and this work).
The isolated BSC proliferated and further showed the MyoD, Myf5 and myogenin expression, which are known to be useful markers for proliferating satellite cells (Allen and Rankin, 1990; Cooper et al., 1999).
Primers used for semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) Gene Primer Sequence(5'-3') SREBP1c Forward ATGATGGTGACACTCAGGCTGCAGTGGTG Reverse TTTCTCTCTCAGAGTAGGGTATCGGTAAGG C/EBP[beta] Forward ATGCAACGCCTGGTGGTCTGG Reverse GCAGTGGCCGGAGGAGGCGAG PPAR[gamma] Forward ATGGGTGAAACCCTGGGAGAT Reverse ATACAAGTCCTTGTAGATTTC GPDH Forward ATGACCGGCAAGAAAGTCTGC Reverse GATCTTGCCGATGAACTGATG Myf5 Forward ATGGACATGATGGACGGCTGC Reverse TAGCACATGATAGATGAGCCT MyoD Forward ATGGAGTTGACTGTCGCCGCCG Reverse GAGCACCTGGTAAATCGGGTT Actin Forward GCCACGAGGCCCAGAGCAAG Reverse GGGGCCACACGCAGCTCATT Gene Size Tm ([degrees]C) SREBP1c 1.2 64 C/EBP[beta] 1.2 kb 58 PPAR[gamma] 1.4 kb 50 GPDH 300 bp 58 Myf5 750 bp 58 MyoD 250 bp 52 Actin 230 bp 52
Several proteins such as myogenic regulatory factors (MRFs), a group of skeletal-muscle specific basic helix-loop-helix (bHLH) transcription factors including of MyoD, Myf5, myogenin, and MRF4 have been documented and linked to myogenic differentiation.
The objective of this study was to analyze the genetic variations of MSTN and MYF5 genes in Nanyang, Qinchuan and Jiaxian cattle breeds and to investigate their corresponding effects on the growth traits of these three Chinese cattle breeds.
MyoD, myoblast determination protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PAX7, paired box 7; Myf5, myogenic factor 5; MyoG, myogenin; FHL1, four and a half LIM domains 1; NFATcl, nuclear factor of activated T cells 1; D.W, distilled water.
In order to further investigate the mechanisms of FGF21 in myogenesis, we first detected the expression of FGF21, [beta]-Klotho, MyoD, Myogenin, Myf5, and cell cycle related genes during myogenic differentiation of C2C12 cells.
In- Out- transcript Gene degree degree RI count NRF1 0 2175 0.99999954 1628.215 SPIB 0 1778 0.999999438 316.215 TFAP2A 0 1721 0.999999419 293.865 MYOD1 0 1713 0.999999416 0.02 TFAP2B 0 1652 0.999999395 0.03 ARNT2 0 1627 0.999999385 0.01 SNAI2 0 1543 0.999999352 7.485 MYOG 0 1435 0.999999303 203.985 MYF5 0 1435 0.999999303 0.985 MYF6 0 1435 0.999999303 0.265 Table 2: The bottom 10 lowest RI values of TFs in the FANTOM network.
Myogenic pathways are primarily governed by transcription factors, MyoD, Myf5, myogenin, and MRF4 at the molecular level.
Silencing of MSTN changed the development of duck embryonic myoblasts by regulating the expression level of the MYOD and MYF5 genes, and affected skeletal muscle growth (Tao et al., 2015).
Place of rice sample collection Coding of Aspergillus isolates No 1 Gadag, Karnataka, India - 2 Bangalore, Karnataka, India BF1,BF2 3 Mysore, Karnataka, India MYF1, MYF2, MYF3, MYF4, MYF5 4 Madikeri, Karnataka, India CF1, CF2, CF3, CF4 5 Haveri, Karnataka, India HF1, HF2 6 Mandya, Karnataka, India - 7 Devenahalli, Karnataka, India DEF1, DEF2 8 Madurai, TamilNadu, India - 9 Shivagangai, Tamil Nadu, India SHF1, SHF2 10 Salem, Tamil Nadu, India - Table 2.