ABCC2

(redirected from MRP2)
Also found in: Acronyms.

ABCC2

A gene on chromosome 10q24 that encodes a protein of the MRP subfamily of the superfamily of ATP-binding cassette (ABC) transporters, which transport various molecules across extra- and intracellular membranes, many of which are involved in multidrug resistance. ABCC2 is found in the canalicular (apical) part of hepatocytes and involved in biliary transport. Its substrates include chemotherapeutics (e.g., vinblastine) and thus contributes to drug resistance in humans.
 
Molecular pathology
ABCC2 is mutated in patients with Dubin-Johnson syndrome.
References in periodicals archive ?
MRP2 is one of the multidrug resistance-associated proteins, which is also regulated by Nrf2.
2012) MDR1 (forward, 5'-GCAGCTGGAAGACAAATACACAAA-3'; reverse, 5'-CCCCAACAT CGTGCACATC-3'), MRP1 (forward 5'-CGGAAACCATCCACGACCCTAATC-3' and reverse 5'-ACCTCCTCATTCGCATCCACCTGG-3'.), MRP2 (forward, 5 CCATCATCCATAGCTTCATTCC 3', and reverse, 5' GTGCGITTCAAACTTGCTCACT 3'), MRP3 (forward, 5'-TGCCATCGACCTGGAGACTGACAAC-3', and reverse, 5' -GACATATTTGGTGTCATTTCCTTCCTG ATG-3'), MRP5 (forward, 5'-GCTCATGATTGTTCTCATGCACGGGCAG3', and reverse, 5'-CAGCCTCCAGATAACTCCACCAGGCGG3'), MVP (forward, 5'-GTGGAATTCC-GGAACTAC-3' and reverse, 5'-CGGAGGTCGTGCAGGCCG-3'); GST-[pi] (forward.
In the present study, the potential of miroestrol and deoxymiroestrol to modify the hepatic enzymes involved in bile salt transportation including BSEP and MRP2, were examined in comparison with estradiol.
RNA expression of MDR1/P-glycoprotein, DNA-topoisomerase I, and MRP2 in ovarian carcinoma patients: correlation with chemotherapeutic response.
The Mg mrp1 and Mg mrp2 genes were used to assess the quality of these reference genes.
MRP2 (ABCC2) transports taxanes and confers paclitaxel resistance and both processes are stimulated by probenecid.
(27-30) Nrf2 also upregulates proteins responsible for Phase III detoxification (P-gp, BCRP, and MRP2) and the transfer of toxic substances out of the cell and central nervous system.
Compared to other PET tracers developed to study liver transporters which are transported quite selectively by the OATPs and MRP2 and BCRP [3,4] bile acid-based tracers such as [[sup.18]F] LCATD, [[sup.18]F]FCA and [[sup.11]C]Cholylsarcosine are generally handled by the same transporters involved in uptake and efflux of endogenous bile acids (NTCP, OATP1B1, OATP1B3, BSEP, and MRP2) [24-26], making them the best candidates to study physiology and pathophysiology of the hepatic bile acid transport in vivo [22,23,27].
It has been shown that canalicular immunostaining of the BSEP, MDR3, and MRP2 proteins is preserved in the liver graft biopsies and no discernible changes in BSEP immunoreactivity distribution between the apical membrane and the cytoplasm have been reported; nonetheless, de novo polyclonal inhibitory antibodies directed against the first extracellular loop of BSEP have been observed in the posttransplant serum of patients, a condition known as Autoimmune BSEP Disease (AIBD) [56, 57].
The obtained HLCs exhibited a hepatic characteristic, including expression of the hepatic marker proteins albumin (ALB), hepatic nuclear factor 4 (HNF4), n-fetoprotein (AFP), multidrug resistance-associated protein 2 (MRP2), and cytokeratin-18 (CK18) (Figure 1(b)).
Horie, "LPS-induced dissociation of multidrug resistance-associated protein 2 (Mrp2) and radixin is associated with Mrp2 selective internalization in rats," Biochemical Pharmacology, vol.
Fries, "ET-1 induced downregulation of MRP2 via miRNA 133a--a marker for tubular nephrotoxicity?," American Journal of Nephrology, vol.