Lys

(redirected from Lyss)
Also found in: Dictionary, Acronyms, Encyclopedia, Wikipedia.

Lys

Abbreviation for lysine or lysyl.

Lys

lysine.

Lys

abbreviation for lysine.

LYS

Abbreviation for:
life-years saved  
lysine

Lys

Abbreviation for lysine, or its radicals in peptides.

Lys

abbrev. LYSINE.

Lys

Abbreviation for lysine.

Lys

lysine.
References in periodicals archive ?
Primer pairs used for PCR of chlamydiaceae species and strains Sequence (5' Length of Primer [right sequence, Locus Region name arrow] 3') bp glyA CT432 FglyA GAAGACTGTGGCGCTGTTTTATGG 522 RglyA CTTCCTGAGCGATCCCTTCTGAC mdhC CT376 FmdhC GGAGATGTTTTTGGCCTTGATTGT 519 RmdhC CGATTACTGCACTACCACGACTCT pdhA CT245 FpdhA CTACAGAAGCCCGAGTTTTT 549 RpdhA CTGTTTGTTGCATGTGGTGATAAG yhbG CT653 FyhbG TCAAGTCAATGCAGGAGAAAT 504 RyhbG GATAGTGTTGACGTACCATAGGAT pykF CT332 FpykF ATCTTATCGCTGCTTCGTT 525 RpykF CAGCAATAATAGGGAGATA lysS CT781 FlysS GAAGGAATCGATAGAACGCATAAT 576 RlysS ATACGCCGCATAACAGGGAAAAAC leuS CT209 FleuS TCCCTTGGTCGATCTCCTCAC 519 RleuS GGGCATCGCAAAAACGTAAATAGT Table 2.
Address : l~attention de Christian Gautschi, Marktplatz 6, 3250 Lyss, Suisse,
The main road axis forms the Bielstrasse which the two motorway exits Lyss
This report is based, in part, on contributions by J Davies-Cole, PhD, District of Columbia Dept of Health; S Lyss, MD, and J Blair, PhD, Office of Workforce and Career Development, CDC.
All inquiries to be faxed to KRJ 314-432-6131 (Attn: Michael Lyss, JoAnn Brookes)or e-mailed to the following: mslyss@krjarch.
Invitation to tender : Based on the law on public procurement, the canton of Bern (EuBG) of 11 June 2002 and the associated Regulation (EuBV) opened the Commune Lyss the competition for next order:
Major organization : STIFTUNG HEILPEaDAGOGISCHE SCHULE LYSS
Feintool engineering company of Lyss, which manufacturers cutting equipment, reported full-year net profit of CHF1.
Thomas Kramer is a psychologist who works as a career counselor at the Professional Information Center in Lyss.
Tenders are invited for IT replacement elementary school Lyss
Contractor address : Grenzstrasse 20B, 3250 Lyss, Switzerland