LSM12

LSM12

A gene on chromosome 17q21.31 that encodes a ribonucleoprotein of unknown function.
References in periodicals archive ?
The oligonucleotide primers for family 1 were LSM12, 5'CCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT3' (23) and SKH63, 5'TTTCTGGCTCAT(C and T)AACTGCTTTC3' (at position 12 C and T in a 1:1 ratio) and for family 2 were LSM12, 5'CCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT3' and SKH52, 5'TGGGGGTGGAGTTTCTTCTTCATCT3'.