LDLR


Also found in: Financial, Acronyms, Encyclopedia.

LDLR

A gene on chromosome 19p13.2 that encodes a cell surface protein involved in receptor-mediated endocytosis of low-density lipoprotein (LDL), the major cholesterol-carrying lipoprotein of plasma, which it transports into cells by endocytosis. Internalisation of the receptor-ligand complex requires clustering into clathrin-coated pits.
References in periodicals archive ?
Gene Primer Sequence (5'-3') HMGCR Forward TGTCOTGATGGCAGCCTTG Reverse CGCGCTTCAGTTCAGTGTCAG LDLR Forward GCAGTAGCTCGCTCTCGTTG Reverse TGGCAATGGATCCCGGAAAG SREBF2 Forward AAGGCTGGCCCATAGCTTC Reverse GCAGTAGCTCGCTCTCGTTG VLDLR Forward AGCGCTTCTGTAGGACACAC Reverse CTTCAGCGCTGGCTCTGTTA ACACA Forward GACAGAGGAAGATGGCGTCC Reverse AGATGTGCTGGGTCATGTGG [beta]-actin Forward TCAAGATCATTGCTCCTCCTGAG Reverse CTCCTGCTTGCTGATCCACA Table 2 Effect of geraniol (C) in body and liver weight and in the food intake of mice during a 3-week experimental period.
The LDLR deficient mouse as a model for aortic calcification and quantification by micro-computed tomography.
More than 1,000 mutations have been described in the LDLR gene in different populations.
063 Electrophoresis broad[beta] [beta] Apoproteins B100, E B100 Core lipid (mass) TG=CE CE [much greater than] TG Subspeciation Large (A) Small (B) Modulation HL, CETP LCAT, HL, CETP Receptors LRP, LDLR LDLR Cholesterol 0 3 concentration--in fasting (mmol/l) Lipoproteins HDL Size (nm) 3-12 Density (g/ml) 1.
Out of total one hundred and twenty cases of hyperlipidemia, forty two patients diagnosed with 'classical' FH tested positive for one of the locally defined founder-type LDLR gene mutations.
All patients were screened for locally prevalent (9) LDLR mutations.
The primary antibodies used in western blot included anti-rabbit CYP7A1 (1:250), anti-rabbit LDLR (1:1000), anti-rabbit HMGR (1:250), anti-rabbit ASBT (1:250) and anti-rabbit B-actin (1:250), secondary antibodies were HRP (1:5000).
Twenty pairs of primers were designed to cover a part of the promoter region and all 18 exons of the LDLR gene (RefSeq NM_000527.
Contrary to the accepted hypothesis positing downregulation of low-density lipoprotein receptor (LDLR) in humans, expression of the human APOE4 isoform combined with increased LDLR was harmful in genetically modified mice when red a high-fat Western diet, predicting important interactions between genotype/phenotype and exposure.
HeFH, which affects about 1 in 500 people, is an autosomal dominant genetic disorder caused by heterozygous mutations in the LDLR gene, which encodes the LDL-C receptor.
Recently, a critical role for the PCSK9 protein was found in the cellular processing of the LDLR (2, 3), and it has subsequently been reported that mutations in the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene associate with wide variation in LDL cholesterol (LDL-C) concentrations.
In these studies, double-stranded "anti-gene" RNAs (agRNAs) targeting the promoter region of the LDL receptor (LDLR) were discovered that increase LDLR expression up to four-fold.