Using peripheral blood samples, the presence of MPL W515L/K mutations and JAK-2 V617F mutation were analyzed by real-time polymerase chain reaction.
Results: In our study, MPL W515L/K or JAK-2 V617F mutations were not observed in healthy controls.
Conclusion: MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V6171 mutation.
Key Words: MPL W515L/K mutations, JAK-2 V617F mutation, Myeloproliferative neoplasms, Essential thrombocythemia, Primary myelofibrosis
W515L/K ve JAK-2 V617F mutasyon varligi periferik kan ornekleri kullanilarak gercek zamanli polimeraz zincir reaksiyonu yontemi ile analiz edildi.
Bulgular: Saglikli kontrol bireylerinde W5151L/K veya JAK-2 V617F mutasyonu saptanmadi.
Sonuc: W515L/K mutasyon JAK-2 V617F negatif olan veya Ph kromozomuna sahip olmayan MPN hastalarinda klonalitenin saptanmasinda yardimci olabilir.
Anahtar Sozcukler: MPL W515L/K mutasyonlan, JAK-2 V617F mutasyonu, Miyeloproliferatif neoplazmlar, Esansiyel trombositemi, Primer miyelofibroz
Janus kinase-2 (JAK-2) is a cytoplasmic tyrosine kinase and has an important role in intracellular signal transduction in hematopoietic cells through the erythropoietin, thrombopoietin (TPO), interleukin-3, granulocyte colony stimulating factor, and granulocyte-macrophage colony stimulating factor receptors.
Sequence analysis of the MPL gene coding TPO receptor led to discovery of a new molecular abnormality in JAK-2 mutation-negative MPN patients.
All samples were analyzed for JAK-2 V617F mutation and MPL W515L/K mutations.
For the JAK-2 V617F LightCycler assay, polymerase chain reaction (PCR) was carried out in capillaries in a total reaction volume of 20 [micro]L containing 25 ng of genomic DNA, 200 [micro]mol/L of dNTPs, 4 mmol/L of Mg[Cl.sub.2], 0.1 pmol/L of forward primer (TTCCTTAGTCTITCTTTGAAGGT), 0.5 [micro]mol/L of reverse primer (GTGATCCTGAAACTGAATTTTCT), and 0.2 [micro]mol/L each of the sensor (5'-ATGGAGTATGTGTCTATGGAGTATGTGTCTGTGG-fluorescein-3') and anchor (5'-LCR640-ACGAGAGTAAGTAAAACTACAGGTC- phosphate-3') probes using the following PCR program: initial denaturation at 95 [degrees]C for 10 min and 45 amplification cycles at 55[degrees]C for 10 s and 72 [degrees]C for 10 s.