(redirected from JAK-2)


A gene on chromosome 9p24 that encodes a non-receptor protein tyrosine kinase, which is involved in a subset of cytokine receptor signalling pathways, including for cell growth, development, differentiation and histone modifications. JAK2 mediates essential signalling events in both innate and adaptive immunity, and is required for responses to gamma interferon. It plays a key role in signal transduction by associating with type-I receptors (e.g., growth hormone (GHR), prolactin (PRLR), leptin (LEPR), erythropoietin (EPOR), thrombopoietin (THPO)) or type-II receptors (e.g., IFN-alpha, IFN-beta, IFN-gamma and a wide range of interleukins).
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Using peripheral blood samples, the presence of MPL W515L/K mutations and JAK-2 V617F mutation were analyzed by real-time polymerase chain reaction.
Results: In our study, MPL W515L/K or JAK-2 V617F mutations were not observed in healthy controls.
Conclusion: MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V6171 mutation.
Key Words: MPL W515L/K mutations, JAK-2 V617F mutation, Myeloproliferative neoplasms, Essential thrombocythemia, Primary myelofibrosis
W515L/K ve JAK-2 V617F mutasyon varligi periferik kan ornekleri kullanilarak gercek zamanli polimeraz zincir reaksiyonu yontemi ile analiz edildi.
Bulgular: Saglikli kontrol bireylerinde W5151L/K veya JAK-2 V617F mutasyonu saptanmadi.
Sonuc: W515L/K mutasyon JAK-2 V617F negatif olan veya Ph kromozomuna sahip olmayan MPN hastalarinda klonalitenin saptanmasinda yardimci olabilir.
Anahtar Sozcukler: MPL W515L/K mutasyonlan, JAK-2 V617F mutasyonu, Miyeloproliferatif neoplazmlar, Esansiyel trombositemi, Primer miyelofibroz
Janus kinase-2 (JAK-2) is a cytoplasmic tyrosine kinase and has an important role in intracellular signal transduction in hematopoietic cells through the erythropoietin, thrombopoietin (TPO), interleukin-3, granulocyte colony stimulating factor, and granulocyte-macrophage colony stimulating factor receptors.
Sequence analysis of the MPL gene coding TPO receptor led to discovery of a new molecular abnormality in JAK-2 mutation-negative MPN patients.
All samples were analyzed for JAK-2 V617F mutation and MPL W515L/K mutations.
For the JAK-2 V617F LightCycler assay, polymerase chain reaction (PCR) was carried out in capillaries in a total reaction volume of 20 [micro]L containing 25 ng of genomic DNA, 200 [micro]mol/L of dNTPs, 4 mmol/L of Mg[Cl.sub.2], 0.1 pmol/L of forward primer (TTCCTTAGTCTITCTTTGAAGGT), 0.5 [micro]mol/L of reverse primer (GTGATCCTGAAACTGAATTTTCT), and 0.2 [micro]mol/L each of the sensor (5'-ATGGAGTATGTGTCTATGGAGTATGTGTCTGTGG-fluorescein-3') and anchor (5'-LCR640-ACGAGAGTAAGTAAAACTACAGGTC- phosphate-3') probes using the following PCR program: initial denaturation at 95 [degrees]C for 10 min and 45 amplification cycles at 55[degrees]C for 10 s and 72 [degrees]C for 10 s.