IL17A

(redirected from Il-17)
Also found in: Dictionary, Thesaurus, Encyclopedia.
Related to Il-17: IL-2, IL-23

IL17A

A gene on chromosome 6p12 that encodes interleukin-17A, a proinflammatory cytokine produced by activated T cells which regulates NF-kappaB and mitogen-activated protein kinases. It upregulates IL6 and cyclooxygenase-2 and increases nitric oxide production.

Molecular pathology
IL17A is overexpressed in rheumatoid arthritis, psoriasis and multiple sclerosis.
References in periodicals archive ?
In an intent-to-treat analysis, Psoriasis Area and Severity Index (PASI) 75, 90, and 100 responses at week 52 didn't differ significantly between the IL-17 inhibitor-naive and -experienced groups.
IL-17 and IL-23 were significantly higher in the RSA group than in the control group (IL-17, RSA 320.
TH-17 cells and serum IL-17 in rheumatoid arthritis patients: Correlation with disease activity and severity.
Biologic agents against IL-12, IL-23 and IL-17 such as briakinumab, ustekinumab and brodalumab respectively are being developed22.
In addition, the levels of cytokines, IL-17 and IL-10 related to Th17 and Treg, respectively, were determined in plasma by ELISA.
According to the mRNA sequences of IL-17, IL-23, IL-10, TGF-b1 provided by the GeneBank, the primers were designed as the following: IL-17-F:
21) This cytokine, similar to IL-17, is a pro-inflammatory cytokine but one of its key roles is protecting hepatocytes from injury by increasing proliferative and antiapoptotic responses.
IL-17 cytokine acts as a potent mediator of immune reactions by increasing chemokine production in various tissues, facilitating recruitment of monocytes and neutrophils to inflammation sites (Monteleone et al.
mRNA levels were determined by real-time PCR using the primers as follows: IFN-[gamma] forward, GTGGAGACCATCAAGGAAGAC; IFN-[gamma] reverse, TATTGCTTTGCGTTGGACAT; IL-4 forward, CGGCAGTTCTACAGCCACCA; IL-4 reverse, TCCTGTCGAGCCGTTTCAG; RORC forward, TGAGAAGGACAGGGAGCCAA; RORC reverse, CCACAGATTTTGCAAGGGATCA; IL-17 forward, GCTACGGTGCAGGTAAAGTTC; IL-17 reverse, GCAGAAGTGCATTTGACAAGAGA; GAPDH forward, ATCAAGATCATTGCTCCTCCTGAG; GAPDH reverse, CTGCTTGCTGATCCACATCTG.
The levels of IL-17, IL-18, IL-23, and MCP-3 in the serum of OND and MS patients were detectable in 21% of samples for IL-17 (16 OND and 22 MS), 86% for IL-18 (79 OND and 77 MS), 71% for IL-23 (65 OND and 64 MS), and 61% for MCP-3 (55 OND and 55 MS).
Researchers measured the quality of life and health benefits and the effects of the treatment on the serum levels of IL-17 and IL-22 that are thought to play a major role in this disorder.
The research group is the first to look at the interaction between mesenchymal stem cells and IL-17, a powerful protein that naturally occurs in the body during times of severe inflammation, such as during transplant rejection.