ITGA3

ITGA3

A gene on chromosome 17q21.33 that encodes an integrin alpha-chain protein which, like all integrins, forms a heterodimer with a beta chain, thereby participating in an array of cell-cell and cell-matrix interactions, playing a major role in cell migration, organ and tissue development and differentiation. Alpha 3 undergoes post-translational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that bind to beta-1 chain, forming an integrin that interacts with many extracellular-matrix proteins, together serving as a receptor for fibronectin, laminin, collagen, epiligrin, thrombospondin and CSPG4.
Mentioned in ?
References in periodicals archive ?
Primers used for targeted genes in this study Target Primer Sequence (5'-3') GAPDH Sense GGGTGGAGCCAAACGGGTC Antisense GGAGTTGCTGTTGAAGTCGCA SYNPO Sense GCCAGGGACCAGCCAGATA Antisense AGGAGCCCAGGCCTTCTCT ITGA3 Sense GCCAAGCTAATGAGACCATC Antisense TCAGCACGAGTGCTCGAGACTTG 1TGB1 Sense AACGAGGTCATGGTTCATGTTGTG Antisense GCATTCAGTGTTGTGGGATTTGC ERK Sense AAAGAATTCGCCCGTTCATTCCTTTGCT Antisense AAAGCGGCCGCTTCTTCATCGCCTCTTCC DDIT3 Sense GAGTTGGAGGCGTGGTATGA Antisense CCTTGGTGGCGATTGGTGAA ERK: Extracellular signal-regulated kinase
8E-9 CACNB1, ALPL, CDH1, ITGA3, SERPINB10, TAF4B, ABCB10, IRF8 Cell proliferation ATF3, MK167, S100A6, FTH1, DHCR7 2.