ITGA3

ITGA3

A gene on chromosome 17q21.33 that encodes an integrin alpha-chain protein which, like all integrins, forms a heterodimer with a beta chain, thereby participating in an array of cell-cell and cell-matrix interactions, playing a major role in cell migration, organ and tissue development and differentiation. Alpha 3 undergoes post-translational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that bind to beta-1 chain, forming an integrin that interacts with many extracellular-matrix proteins, together serving as a receptor for fibronectin, laminin, collagen, epiligrin, thrombospondin and CSPG4.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
Moreover, two integrins (Itga3, Itga7) were detected in this group, which are cell membrane proteins but not specific for immune cells.
Primers used for targeted genes in this study Target Primer Sequence (5'-3') GAPDH Sense GGGTGGAGCCAAACGGGTC Antisense GGAGTTGCTGTTGAAGTCGCA SYNPO Sense GCCAGGGACCAGCCAGATA Antisense AGGAGCCCAGGCCTTCTCT ITGA3 Sense GCCAAGCTAATGAGACCATC Antisense TCAGCACGAGTGCTCGAGACTTG 1TGB1 Sense AACGAGGTCATGGTTCATGTTGTG Antisense GCATTCAGTGTTGTGGGATTTGC ERK Sense AAAGAATTCGCCCGTTCATTCCTTTGCT Antisense AAAGCGGCCGCTTCTTCATCGCCTCTTCC DDIT3 Sense GAGTTGGAGGCGTGGTATGA Antisense CCTTGGTGGCGATTGGTGAA ERK: Extracellular signal-regulated kinase
Some of these theoretical targets have been reported to be invadopodia-associated proteins, including tyrosine kinase Arg (ABL2), integrin [alpha]3 (ITGA3), podocalyxin-like protein (PODXL), protein kinase C [alpha] (PRKCA), podoplanin (PDPN), Tks4 (SH3PXD2B), and ADAM metallopeptidase with thrombospondin type 1 motif, 1 (ADAMTS1).
Gene ontology: biological Genes p-Value process terms Cell cycle CCNB1, CCNB2, MNAT1, CDC2, 2.7 E-14 CDKN 1 A, CDKN3, CDKN2A, ANAPC1, CDK10 Cellular metabolism KRT15, KIF1B, ZNF697, 4.3E-13 PRG2, P2RY2,IMMP2L Growth factor and growth BMP-2, TCF[beta]1, VEGF, 1.2E-11 factor receptor activity BMP8B, CSF1, FCFR1, BMPR2, 1GF2R, PDCFB, TGFBR2, NRP1, CCR2 Biosynthetic process CEL, COL11A2, ACPP, MMP14, 1.8E-9 CACNB1, ALPL, CDH1, ITGA3, SERPINB10, TAF4B, ABCB10, IRF8 Cell proliferation ATF3, MK167, S100A6, FTH1, DHCR7 2.1E-8 Signal transduction MAP2K3, MAPK14, MAP3K10, BAMBI, NDRG2, ECM1, SMAD7 5.5E-7 Apoptosis MYC, P53AIP1, ZBTB16, BBC3, 1.3E-5 VHL, CASP3, APITD1 Table 5 KEGG pathway analysis.
We found upregulated ERO1L and ITGA3 and downregulated PLAA ranked in the first class close to LOXL2-e13-DEGs and upregulated MAPK8 ranked in the second class.
For example, ERO1L, ITGA3, PLAA, and MAPK8 were DEGs that ranked the closest to LOXL2-e13.
During renal development, Int[alpha]3 is necessary for normal organogenesis, for in mice with a mutated Itga3 gene abnormal collecting duct, proximal tubule, and glomerular histology can be observed [24, 126].
Except for the elevation of ITGA3 and ITGA7, FCOL1 downregulates the rest alpha integrins (ITGA1, ITGA2, ITGA4, and ITGA8) without impacting ITGA5 and ITGA6.
The quantitative mRNA expression of integrin [alpha]1 (ITGA1, (a)), [alpha]2 (ITGA2, (b)), [alpha]3 (ITGA3, (c)), [alpha]4 (ITGA4, (d)), [alpha]5 (ITGA5, (e)), [alpha]6 (ITGA6, (f)), [alpha]7 (ITGA7, (g)), [alpha]8 (ITGA8, (h)), [beta]1 (ITGB1, (i)), and [beta]3 (ITGB3, (j)) was determined by real-time RT-PCR.
The lens expresses the laminin receptors [alpha]6[beta]1, [alpha]6[beta]4, and integrin and mice lacking either both the itga3 and itga6 or itgb1 genes from the lens develop profound lens abnormalities including loss of the lens epithelium and fiber cell defects [5, 65-67].