ITGA1

ITGA1

A gene on chromosome 5q11.2 that encodes an integrin alpha chain protein which, like all integrins, forms a heterodimer with a beta chain, thereby participating in an array of cell-cell and cell-matrix interactions, playing a major role in cell migration, organ and tissue development and differentiation. The alpha-1 beta-1 heterodimer forms a cell surface receptor for collagen and laminin, is involved in cell-cell adhesion and may play a role in inflammation and fibrosis.
Mentioned in ?
References in periodicals archive ?
Similarly, otogelin like (OTOGL), seizure threshold 2 (SZT2), family with sequence similarity 208 member B (FAM208B), and integrin subunit alpha 1 (ITGA1) each had ranking p-values of <0.05 but only one SNP expected to affect protein function.
Last, recent studies revealed that some non-HLA genes, such as sialyltransferase ST8SIA2 , the complement regulator CSMD1 , and the integrin ITGA1 , may also be associated with cardiac manifestations of NLS.[14],[24] From maternal aspect, it was found that polymorphism in the interferon regulatory factor 5 gene was associated with asymptomatic mothers who had high-titer anti-Ro/SSA autoantibodies.[14],[25]
It is shown in Figure 6 that ITGA1 and ITGB1 were simultaneously upregulated to 1.31 [+ or -] 0.04-fold (p <0.01) and 1.87 [+ or -] 0.09-fold (p <0.01) by Npnt, respectively.
The results highlighted that Npnt triggered the upregulation of ITGA1 (1.31 [+ or -] 0.04-fold), ITGA4 (1.40 [+ or -] 0.05-fold), ITGA7 (1.33 [+ or -] 0.07-fold), and ITGB1 (1.87 [+ or -] 0.09-fold).
Moreover, Npnt acts as a bioactive signal to initiate the upregulation of ITGA1, ITGA4, ITGA7, and ITGB1 as early as day five.
The quantitative mRNA expression of integrin [alpha]1 (ITGA1, (a)), [alpha]2 (ITGA2, (b)), [alpha]3 (ITGA3, (c)), [alpha]4 (ITGA4, (d)), [alpha]5 (ITGA5, (e)), [alpha]6 (ITGA6, (f)), [alpha]7 (ITGA7, (g)), [alpha]8 (ITGA8, (h)), [beta]1 (ITGB1, (i)), and [beta]3 (ITGB3, (j)) was determined by real-time RT-PCR.
number Gene name Forward primer 1 IGF-1 5' TCTTGAAGGTGAAGATGCACACCA 3' 2 COL14A1 5' AAGCCCAGAGTCAAAGTTGTGGA 3' 3 MMP 2 5' GGCCCTGTCACTCCTGAGAT 3' 4 ITGA1 5' GGTTCCTACTTTGGCAGTATT 3' 5 ITGA6 5' TCCCTGAACCTAACGGAGTCT 3' 6 SDF-1 5'ATGAACGCCAAGGTCGTGGTC 3' 7 WISP-1 5' AGAGCCGCCTCTGCAACTT 3' 8 GAPDH 5' GAGTCAACGGATTTGGTCGT 3' 9 VTN 5' CGAGGAGAAAAACAATGCCAC 3' 10 TSG6 5' CCCATTGTGAAGCCAGGGCCCAACTG 3' 11 HGF 5' TCACGAGCATGACATGACTCC 3' S.
Moreover, other putative markers can be used to isolate SG stem/progenitor cells including KRT5 (Cytokeratin 5), CD49f, CD29 (Itga1), CD133 (Prom1), Sca1, CD44, CD34, CD90 (Thy1), CD105, CD9, and CD81, but only few populations were proven to actively restore damaged glands [11, 42-45].