Also found in: Acronyms.


A gene on chromosome 4q34.1-q35.1 that encodes interferon regulatory factor 2, a protein of the interferon regulatory transcription factor (IRF) family, which competitively inhibits the IRF1-mediated transcriptional activation of interferons alpha and beta, and presumably other genes whose transcription is activated by IRF1.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
4R pcbd PCBD.2F/ PCBD.4R (external) 1.5 mM PCBD.3F/ PCBD.3R (internal) mb MYO2 2.0 mM MYO3F nat15 NAT.4F 2.0 mM NAT.5R irf2 IRF2.2F 2.0 mM IRF2.3R Locus Annealing temp[degrees] Reference rho 60[degrees] Kimball et al.
Gene Primer (5'-3') forward Length (bp) and reverse NM_001038050 ISG12 F:cttcaccagtgcaggaatca 195 R:cccaaaaatttggacacgag NM_174366 ISG15 F:tgcagaactgcatctccatc 199 R:ttcatgaggccgtattcctc AF069133 ISG17 F:catttgggtgtgagcatttg 159 R:ttgctgatgggattgtgaaa NM_173940 MX1 F:gtccctgctaacgtggacat 155 R:accaggtttctcaccacgtc NM_173941.2 MX2 F:gcagatcaaggcactcatca 168 R:accaggtctggtttggtcag NM_177432.2 IRF1 F:gctgggacatcaacaaggat 163 R:ctgctctggtccttcacctc AJ490936.1 IRF2 F:aaactgggccatccatacag 192 R:ttagaaggccgctcagacat BC102948 ACTB F:ctcttccagccttccttcct 178 R:gggcagtgatctctttctgc
Shu, "Regulation of IRF2 transcriptional activity by its sumoylation," Biochemical and Biophysical Research Communications, vol.
Second, it induces expression of interferon regulatory factor 2 (IRF2) in uterine LE/sGE to silence expression of ESR1 and classical IFNT stimulated genes, while, in concert with progesterone (P4), enhancing expression of genes by uterine LE/sGE required for conceptus development, implantation and successful development of the conceptus to term.
In ewes, IFNT induces expression of IRF2, a potent suppressor of transcription, which silences transcription of ESR1.