Gene Primer (5'-3') forward Length (bp) and reverse NM_001038050 ISG12 F:cttcaccagtgcaggaatca 195 R:cccaaaaatttggacacgag NM_174366 ISG15 F:tgcagaactgcatctccatc 199 R:ttcatgaggccgtattcctc AF069133 ISG17 F:catttgggtgtgagcatttg 159 R:ttgctgatgggattgtgaaa NM_173940 MX1 F:gtccctgctaacgtggacat 155 R:accaggtttctcaccacgtc NM_173941.2 MX2 F:gcagatcaaggcactcatca 168 R:accaggtctggtttggtcag NM_177432.2 IRF1 F:gctgggacatcaacaaggat 163 R:ctgctctggtccttcacctc AJ490936.1
IRF2 F:aaactgggccatccatacag 192 R:ttagaaggccgctcagacat BC102948 ACTB F:ctcttccagccttccttcct 178 R:gggcagtgatctctttctgc
Second, it induces expression of interferon regulatory factor 2 (IRF2) in uterine LE/sGE to silence expression of ESR1 and classical IFNT stimulated genes, while, in concert with progesterone (P4), enhancing expression of genes by uterine LE/sGE required for conceptus development, implantation and successful development of the conceptus to term.
In ewes, IFNT induces expression of IRF2, a potent suppressor of transcription, which silences transcription of ESR1.