IRF2

Also found in: Acronyms.

IRF2

A gene on chromosome 4q34.1-q35.1 that encodes interferon regulatory factor 2, a protein of the interferon regulatory transcription factor (IRF) family, which competitively inhibits the IRF1-mediated transcriptional activation of interferons alpha and beta, and presumably other genes whose transcription is activated by IRF1.

References in periodicals archive ?

4R pcbd PCBD.2F/ PCBD.4R (external) 1.5 mM PCBD.3F/ PCBD.3R (internal) mb MYO2 2.0 mM MYO3F nat15 NAT.4F 2.0 mM NAT.5R irf2 IRF2.2F 2.0 mM IRF2.3R Locus Annealing temp[degrees] Reference rho 60[degrees] Kimball et al.

Historical demography of bird populations from Hispaniola assessed by nuclear and mitochondrial gene sequences

Gene Primer (5'-3') forward Length (bp) and reverse NM_001038050 ISG12 F:cttcaccagtgcaggaatca 195 R:cccaaaaatttggacacgag NM_174366 ISG15 F:tgcagaactgcatctccatc 199 R:ttcatgaggccgtattcctc AF069133 ISG17 F:catttgggtgtgagcatttg 159 R:ttgctgatgggattgtgaaa NM_173940 MX1 F:gtccctgctaacgtggacat 155 R:accaggtttctcaccacgtc NM_173941.2 MX2 F:gcagatcaaggcactcatca 168 R:accaggtctggtttggtcag NM_177432.2 IRF1 F:gctgggacatcaacaaggat 163 R:ctgctctggtccttcacctc AJ490936.1 IRF2 F:aaactgggccatccatacag 192 R:ttagaaggccgctcagacat BC102948 ACTB F:ctcttccagccttccttcct 178 R:gggcagtgatctctttctgc

Regulation of interferon-stimulated gene (ISG)12, ISG15, and MX1 and MX2 by conceptus interferons (IFNTs) in bovine uterine epithelial cells

Shu, "Regulation of IRF2 transcriptional activity by its sumoylation," Biochemical and Biophysical Research Communications, vol.

Interferon-regulatory factors determine macrophage phenotype polarization

Second, it induces expression of interferon regulatory factor 2 (IRF2) in uterine LE/sGE to silence expression of ESR1 and classical IFNT stimulated genes, while, in concert with progesterone (P4), enhancing expression of genes by uterine LE/sGE required for conceptus development, implantation and successful development of the conceptus to term.

In ewes, IFNT induces expression of IRF2, a potent suppressor of transcription, which silences transcription of ESR1.

Roles of conceptus secretory proteins in establishment and maintenance of pregnancy in ruminants

Full browser ?

CITE

Site: Follow: Share:

Open / Close