INSR


Also found in: Acronyms.

INSR

A gene on chromosome 19p13.3-p13.2 that encodes insulin receptor, the binding of insulin to which stimulates glucose uptake.

Molecular pathology
Defects of INSR cause Rabson-Mendenhall syndrome, leprechaunism and hyperinsulinaemic hypoglycaemia type 5.
References in periodicals archive ?
Insulin and TZDs independently have been shown to increase expression of INSR, IRS-1, PPAR[gamma] and StAR protein in human ovarian cells (46).
The receptor kinase activity was optimal inspite of decrease in insulin induced INSR autophosphorylation suggesting a defect in signaling cascade between INSR and glucose transport (12).
A gene expression study carried out by Corton et al (66) with omental adipose tissue from PCOS women showed overexpression of ectoenzyme nucleotide pyrophosphate phosphodiesterase 1 (ENPPI), which is a negative regulator of INSR tyrosine kinase activity and the regulatory p85[alpha] subunit of PI3K which resulted in decreased PI3K activity.
Increased basal autophosphorylation of serine residues of INSR and subsequent decrease in insulin stimulated tyrosine autophosphorylation of INSR were reported in 50 per cent of cultured skin fibroblasts from women with PCOS (19).
The expression of signaling proteins upstream of PI3K like INSR, IRS-1 and also p85 subunit of PI3K were normal but that of IRS-2 was markedly increased19,12.
Like fibroblasts, skeletal muscle from women with PCOS also showed impaired insulin action along with constitutive serine phosphorylation and decreased tyrosine kinase activity of INSR in vitro (2).
Ectoenzyme nucleotide pyrophosphate phosphodiesterase (ENPP1): ENPP1 (also known as PC-1, plasma cell differentiation antigen 1) has been identified as a factor potentially contributes to IR by binding to INSR and affecting its signaling.
A novel SNP at exon 17 of INSR is associated with decreased insulin sensitivity in Chinese women with PCOS.
Genetic variation in exon 17 of INSR is associated with insulin resistance and hyperandrogenemia among lean Indian women with polycystic ovary syndrome.
And hypothalamic INSR, POMC, CRH, and NPY genes were also not changed by peripheral insulin administration.
bp) [beta]-actin L08165 F: TGCGTGACATCAAGGAGAAG 300 R: TGCCAGGGTACATTGTGGTA 18S AF173612 F: ATAACGAACGAGACTCT GGCA 136 R: CGGACAT C TAAGGGCAT CACA NPY M87294 F: GAGGCACTACATCAACCTCATCAC 101 R: TGTTTTCTGTGCTTTCCCTCAA CRH NM 001123031 F: CTCCCTGGACCTGACTTTCC 86 R: TGTTGCTGTGGGCTTGCT INSR AF111857 F: CAAACGGTGACCAAGCCTCA 186 R: CATCCTGCCCATCAAACTCCG POMC NM_001031098 F: CGCTACGGCGGCTTCA 88 R: TCTTGTAGGCGCTTTTGACGAT NPY, neuropeptide Y; CRH, corticotropin-releasing hormone; INSR, insulin receptor; POMC, proopiomelanocortin.
The INSRs are also widely distributed in the central nervous system, and regulate vital physiological processes in mammals (Pagotto, 2009).