IL8


Also found in: Dictionary, Encyclopedia.

IL8

A gene on chromosome 4q13-q21 that encodes interleukin-8, a cytokine belonging to the CXC chemokine family. IL8 is a major mediator of inflammation, acting as a chemoattractant for neutrophils, basophils and T-cells, and is a potent angiogenic factor.

Molecular pathology
IL8 is a candidate gene for bronchiolitis.
References in periodicals archive ?
Furthermore, this report also reviews key players involved in C-X-C Chemokine Receptor Type 2 (CDw128b or GRO/MGSA Receptor or High Affinity Interleukin 8 Receptor B or IL8 Receptor Type 2 or CD182 or CXCR2) targeted therapeutics development with respective active and dormant or discontinued projects.
2: Primer sequences Gene Forward primer sequence Reverse primer sequence ACTA2 CTGACCCTGAAGTACCCGATA GAGTGGTGCCAGATCTTTTCC COL1A1 AGATCGAGAACATCCGGAG AGTACTCTCCACTCTTCCAG GAPDH ATCTTCTTTTGCGTCGCCAG TTCCCCATGGTGTCTGAGC IL1B TGGGTAATTTTTGGGATCTACACTCT AATCTGTACCTGTCCTGCGTGTT IL6 AGCCCACCGGGAACGA GGACCGAAGGCGCTTGT IL8 AGAAGTTTTTGAAGAGGGCTGAGA CAGACCCACACAATACATGAAGTG PLOD2 AAGACTCCCCTACTCCGGAAA AGCAGTGGATAATAGCCTTCCAA SERPINE1 GTCTG CTGTGCACCATCCCCCATC TTGTCATCAATCTTGAATCCCATA TNF TCTTCTCGAACCCCGAGTGA CCTCTGATGGCACCACCAG
High levels of monocyte chemoattractant protein 1 (CCL2), CXCL1, IL6, IL8, and PAI1 were also found in patient ASC CM, irrespective of patient BMI.
The results demonstrated that LPS induced IL6 and TNF-[alpha] secretion of PBMCs but had no effect on IL8 and IL10 secretion.
We applied a flow cytometry-based method utilizing magnetic microspheres conjugated with monoclonal antibodies (Luminex xMAP[R] Technology) to measure the concentrations of eotaxin, GM-CSF, IFNy, IL4, IL5, IL8, IL12(p70), IL13, RANTES, and TNF[alpha].
No statistically significant differences were observed for the expression of the proinflamatory cytokines IL1A, IL6, IL8 and TNF and bone formation genes ALP, COL1 and RUNX2 in HPDL cells treated with PC 15% or MTA or control cells (Figure 6).
Interleukins [interleukin 8 (IL8), interleukin 6 signal transducer (IL6ST), interleukin 7 (IL7), interleukin 15 (IL15), and interleukin 1 receptor type 1 (IL1R1)] and chemokines [C-X-C motif chemokine ligand 2 (CXCL2), C-X-C motif chemokine ligand 6 (CXCL6), C-X-C motif chemokine ligand 10 (CXCL10), C-X-C motif chemokine ligand 11 (CXCL11), C-C motif chemokine ligand 5 (CCL5), and C-C motif chemokine ligand 28 (CCL28)] also were overexpressed in HT-29 cells.
For MEC we measured transcription of MUC1, Interleukin 8 (IL8), and Chemokine (C-C Motif) Ligand 2 (CCL2).
In a study conducted in 2008, it was revealed that recombinant flagella of Vibrio cholerae are able to stimulate IL8 production through the activation of Toll-like receptor 5 (TLR5) and nuclear factor kappa B.
Similar results were seen in the mRNA expression of IL8 in both epithelial cells exposed to PAO1 and TUH-54 strains (data not shown).
In a rabbit model, IL-8 and VEGF levels in serum were elevated with decreasing talc particle size; furthermore pleural fluid IL8 and VEGF levels were higher in the small particle talc group (<5 [micro]um) than in particles of mixed size [21].
Singh, "IL8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis," Journal of Immunology, vol.