IL17A

IL17A

A gene on chromosome 6p12 that encodes interleukin-17A, a proinflammatory cytokine produced by activated T cells which regulates NF-kappaB and mitogen-activated protein kinases. It upregulates IL6 and cyclooxygenase-2 and increases nitric oxide production.

Molecular pathology
IL17A is overexpressed in rheumatoid arthritis, psoriasis and multiple sclerosis.
References in periodicals archive ?
The cytokines detected were IFNI3, IL-10, IL-12p70, IL-13, IL-2, IL-5, IP-10, MiP-1[alpha], MiP-1[beta], IL-6, IL1-RA, GM-CSF, RANTES, IL-1[beta], Eotaxin, Basic FGF, VEGF, PDGF-[beta], MCP-1, IL-8, IL15, IL-17, G-CSF, IL-12p70, IL17A, IL-9 and TNF-[alpha].
Oligonucleotidos empleados en la RT-PCR Tiempo-Real para los genes GAPDH, IL-17 y ROR[gamma]t de alpacas Gen Producto Secuencia (5'-3') Longitud IL17A 200 F ACCGGAACACAAATTCCAAA 20 R GACCAGGATCTCTTGCTGGA 20 RORC 203 F CTGGCCTTTCATCACCATCT 20 R CCCT CAGGT GACT CGAYTT C 20 GAPDH 201 F ATCACTGC CAC C CAGAAGAC 20 R GCACGT CAGAT CCACAACAG 20 Gen ACCESO GENBANK TM GC% IL17A XM_006211540.1 60.21 40 60.35 55 RORC XM_015250159.1 60.07 50 59.83 60 GAPDH XM_006210852.1 60.12 58 60.32 55 Figura 3.
(2016) MCPIP1 RNase is aberrantly distributed in psoriatic epidermis and rapidly induced by IL17A. J.
For example, the IL17A and IL17F gene polymorphisms were not associated with the susceptibility of RA, while they were among the most important cytokines in the pathogenesis of RA.[23]
Supplementation with Microalgae Fatty Acids Increases IL17A, IL-12, IL-4, IL-6, IL-10, and TGF-[beta] but Decreases IFN-[gamma], TNF-[alpha], and IL-5 in Diabetic Mice.
showed that IL17A upregulated COX-2 mRNA and protein in cancer cells lines via NF-[kappa]B and ERK1/2 signalling pathways [15].
Relative mRNA levels of IL17A, IL-23, Treg-related transcription factor FoxP3, and cytokine TGF-3 were measured by using quantitative PCR assay via the primers from Table 1.
Selected cytokines related to acute and chronic inflammation, IL6, IL12, IFN-[gamma], TNF-[alpha], IL2, IL4, IL5, IL13, IL10, TGF-[beta]11, IL17A, and G-CSF, were investigated by RT-PCR (as above reported) and by ELISA (Multi-Analyte ELISArray kit, Qiagen, Milan, Italy) as previously described [39].
Serum levels of IL-17A were evaluated using an ELISA kit ("Thermo Fisher Scientific Human IL17A ELISA Kit") designed to measure human IL-17A in serum.
In fact, the synergic action of the different cytokines induces the expression of IL23R, which in turn activates the STAT signaling pathway leading to the expression of the transcription factor ROR[gamma]t and then the production of Th17-specific cytokines, mainly IL17A and IL17F [15, 16].
Talor et al., "Fatal eosinophilic myocarditis develops in the absence of IFN-[gamma] and IL17A," The Journal of Immunology, vol.