IGF1


Also found in: Financial, Acronyms.

IGF1

A gene on chromosome 12q23.2 that encodes a protein, similar to insulin in structure and function, which belongs to a family of proteins involved in mediating growth and development.

Molecular pathology
IGF1 mutations are a cause of insulin-like growth factor I deficiency.
References in periodicals archive ?
The findings, published in the journal Proceedings of the National Academy of Sciences, back up a recent British study which found girls with higher levels of IGF1 begin menstruation at an earlier age.
1 IGF1 F: TCTCAACATCTCACATCTCT 136 R: AAGCAGCACTTAACTAATTGT NM_001199909 PDK4 F: TGCAATCACCAAAGGTCACCA 87 R: TGCAGTAGCTGAAGCTGTGTT NM_204728 PPARD F: TCTCCAAGCACATCTACAA 75 R: CGGTCAAGATACCTCTCG NM_00166326 PPIA F: GGCTCCCAGTTCTTCATC 143 R: ATCTGCTTGCTCGTCTTG NM_205103 TBP F: TGAATAGCACACGCACTA 178 R: GAGGCAACACATACTGAAC GenBank [T.
In 2006 Rinaldi, using data from the EPIC cohort, reported no association in younger women but a positive association for both IGF1 and IGFBP-3 in women older than 50 years.
The underlying mechanism is likely that CF whole extract up-regulated expression of certain genes for angiogenesis and associated growth factors and receptors, including IGF1, CTGF, NRP2, VEGFR3, HIF1A, MMP2, MMP9, TIMP2, PLG, PLAU, ITGAV, 1TGB3, beta-catenin, PECAM1, ANGPT1, TIE-2, PDGFRB, CDH5, S1PR1, FGF2, Shh, TGFRB1, and Ephrin B2.
And not only that, but CXCL12 and IGF1 were also known to be expressed by bone cells.
GH release is blunted and chronically depressed in SCI, as evidenced by reduced levels of IGF1, a convenient indicator of chronic GH secretion [6-7].
IGF1 has been the most widely studied of the growth factors, and has been shown to potentiate the signaling of AR, even in the absence of androgens.
6 fold increase of platelets (unpublished white paper, Arthrex[R]), a 2-6 fold increase in the growth factors EGF, VEGF, TGF-[beta]1, TGF-[beta]2, PDGF-AB, PDGF-BB, as well as a 10% increase in IGF1 (Engebretesen et al.
Dermal papilla IGF1 ve fibroblast buyume faktoru 7 salgilar, her ikisi de kil folikulunun gelisiminde ve dongusunde etkilidir (37).
To the best of our knowledge, this is the first report on IGF1 levels in [beta]-thalassemia minor cases.
The expression patterns of IGF1, PIT1, and GH1 in the growth and development of the Liangshan pig were quite similar, with higher expression in the intermediate slaughter weight growth phases (67.
IGF1 is a mediator of many biological effects; for example, it increases the absorption of glucose, stimulates myogenesis, inhibits apoptosis, participates in the activation of cell cycle genes, increases the synthesis of lipids, stimulates the production of progesterone in granular cells, and intervenes in the synthesis of DNA, protein, RNA, and in cell proliferation [17].