ICAM1


Also found in: Acronyms.

ICAM1

A gene on chromosome 19p13.3-p13.2 that encodes a cell surface glycoprotein expressed on endothelial cells and cells of the immune system. It binds to integrins CD11a/CD18 or CD11b/CD18, and serves as a cell receptor for rhinoviruses.
References in periodicals archive ?
The association between well-water As and stroke was significantly modified by 11 SNPs in six genes (see Supplemental Material, Table S4), and ICAM1 rs281432 remained significant after FDR adjustment ([p.
For instance, there was evidence of a synergistic interaction between ICAM1 rs281432 and urinary As on CVD (p = 0.
We observed a significant interaction of well-water As with ICAM1 rs128432 and VCAM1 rs3176867 for CVD on both multiplicative and additive scales.
We observed significant interactions of well-water As with rs281432 in ICAM1 and rs3176867 in VCAM1 for CVD.
Among the GIH population (Gujarati Indians in Houston, Texas) in the Hapmap 3 SNP data set, ICAM1 rs28l432 was not found, and no proxy SNPs were identified for VCAM1 rs3176867 (SNAP; Johnson et al.
We estimated significant interactions of As exposure with ICAM1 rs281432 and VCAM1 rs3176867 on CVD.
05) decreased by the addition of 10 [micro]M or 30 [micro]M EGCG, with 30 [micro]M EGCG almost completely inhibiting increases in ICAM1 gene expression induced by TNF-[alpha].
05) upregulated expression of ICAM1, CCL2 and VCAMI genes, and this effect could also be reduced by treatment with EGCG and L-theanine (Fig.
Abbreviations EC epicatechin ECG epicatechin gallate ECC epigallocatechin EGCG epigallocatechin-3-gallate eNOS endothelial nitric oxide synthase HO-1 heme oxygenase-1 ICAM1 intercellular adhesion molecule-1 JNK c-Jun N-terminal kinase HUVEC human umbilical vein endothelial cells 3-MA 3-Methyladenine MCP1 monocyte chemoattractant protein-1 NO nitric oxide PAI-1 plasminogen activator inhibitor-1 ROS reactive oxygen species TNF-[alpha] tumor necrosis factor alpha VCAM1 vascular cell adhesion molecule-1 VEGF vascular endothelial growth factor vWF von Willebrand factor
Genes Forward primer Reverse primer (5' [right arrow] 3') (5' [right arrow] 3') ICAM1 TTGTCTGTTCGGTTTCATGG GTAGCAGAAGCAGTCATAATG VCAM1 GGATTTTCGGAGCAGGAAAG CAAAGGCAGAGTACGCAAACA CCL2 TGAAGGTGGCTGCTATGAGCA AAACTGAAGCTCGCACTCTCG BCL2 TGGGACACAGGCAGGTTC CGCATCAGGAAGGCTACAGTT BAX CAGGCCCTTCAGCACCA GACGGCAACTTCAACTGGG CASP9 CCACCATGAAATGCAGCG CACTGGCTCCAACATCGACT Genes Amplicon (bp) Accession number ICAM1 126 J03132 VCAM1 142 M60335 CCL2 81 NM_002982 BCL2 93 NM_000633 BAX 72 NM_138763 CASP9 65 NM_001229
Our discovery of ICAM1, along with other breast cancer biomarkers including NuMA and RAD21, is the impetus for us to continue developing a breast cancer panel.
In addition to ICAM1, the Company discovered two other genes linked to breast cancer, NuMA and RAD21, which were identified using SEQUENOM technology.