Hyl


Also found in: Acronyms, Encyclopedia.

Hyl

Symbol for hydroxylysine or hydroxylysyl (5Hyl specifically refers to 5-hydroxylysine).
References in periodicals archive ?
Upon the expandable terrace lies an extra special VIP table, reserved for HYL's major partners.
faecalis detection Target Virulence factor Primer Sequence(59-39) Product gene size (bp) asal Aggregation ACA11 GCACGCTATTACGAACTATGA 375 substance ACA12 TAAGAAAGAACATCACCACGA GelE Gelatinase Gel11 TATGACAATGCTTTTTGGGAT 213 Gel12 AGATGCACCCGAAATAATATA cylA Cytolysin CYT I ACTCGGGGATTGATAGGC 688 CYT IIb GCTGCTAAAGCTGCGCTT esp Enterococcal ESP 14F AGATTTCATCTTTGATTCTTGG 510 surface protein ESP 12R AATTGATTCTTTAGCATCTGG hyl Hyaluronidase HYL n1 ACAGAAGAGCTGCAGGAAATG 276 HYL n2 GACTGACGTCCAAGTTTCCAA VanA Vancomycin- vanA 1 GGGAAAACGACAATTGC 175-191 resistant A vanA2 GTACAATGCGGCCGTTA 907-891 VanB Vancomycin- Van B1 ATGGGAAGCCGATAGTC 173-189 resistant B vanB 2 GATTTCGTTCCTCGACC 807-791 Table 2.
Development of a Multiplex PCR for the Detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium.
Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium.
CDI Corporation (NYSE: CDI), an engineering and technology services firm providing differentiated solutions in select global industries, is collaborating with Tenova HYL Technologies, a worldwide supplier of advanced technologies, products and engineering services for the iron & steel and mining industries, and Nucor Corporation.
Gametofitos y esporofitos de Dryopteris wallichiana (Spreng.) Hyl. (Dryopteridaceae-Pteridophyta).
Vilma and Joseph Hyl, Alice and Maurice Moore; family$50
Starting this month, ESI plans to send Emirati employees on a training program in the area of iron ore direct reduction, at Mexican based Tenova HYL, a strategic partner of ESI and Danieli.
Spread of ampicillin/vancomycin-resistant Enterococcus faecium of the epidemic-virulent clonal complex-17 carrying the genes esp and hyl in German hospitals.
It has three unit of DRI plant namely HYL I, HYL II and HYL III.