Hyl


Also found in: Acronyms, Encyclopedia.

Hyl

Symbol for hydroxylysine or hydroxylysyl (5Hyl specifically refers to 5-hydroxylysine).
Mentioned in ?
References in periodicals archive ?
Upon the expandable terrace lies an extra special VIP table, reserved for HYL's major partners.
House Yacht Living Showcases Next-Generation Floating Home, Arkup #1 with Extravagant 5-Night Private Showing on Star Island
faecalis detection Target Virulence factor Primer Sequence(59-39) Product gene size (bp) asal Aggregation ACA11 GCACGCTATTACGAACTATGA 375 substance ACA12 TAAGAAAGAACATCACCACGA GelE Gelatinase Gel11 TATGACAATGCTTTTTGGGAT 213 Gel12 AGATGCACCCGAAATAATATA cylA Cytolysin CYT I ACTCGGGGATTGATAGGC 688 CYT IIb GCTGCTAAAGCTGCGCTT esp Enterococcal ESP 14F AGATTTCATCTTTGATTCTTGG 510 surface protein ESP 12R AATTGATTCTTTAGCATCTGG hyl Hyaluronidase HYL n1 ACAGAAGAGCTGCAGGAAATG 276 HYL n2 GACTGACGTCCAAGTTTCCAA VanA Vancomycin- vanA 1 GGGAAAACGACAATTGC 175-191 resistant A vanA2 GTACAATGCGGCCGTTA 907-891 VanB Vancomycin- Van B1 ATGGGAAGCCGATAGTC 173-189 resistant B vanB 2 GATTTCGTTCCTCGACC 807-791 Table 2.
Mass Spectrometry Technology and qPCR for Detection of Enterococcus faecalis in Diabetic Foot Patients
Development of a Multiplex PCR for the Detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium.
Analysis of biofilm production in Enterococcus faecium strains depending on clinical source
Our data demonstrated that the levels of Hyl, HP, and LP positively correlate with UF size.
Overhydroxylation of Lysine of Collagen Increases Uterine Fibroids Proliferation: Roles of Lysyl Hydroxylases, Lysyl Oxidases, and Matrix Metalloproteinases
Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium.
Incidence of virulence determinants in clinical Enterococcus faecalis and Enterococcus faecium isolates collected in Bulgaria
CDI Corporation (NYSE: CDI), an engineering and technology services firm providing differentiated solutions in select global industries, is collaborating with Tenova HYL Technologies, a worldwide supplier of advanced technologies, products and engineering services for the iron & steel and mining industries, and Nucor Corporation.
-CDI Corporation collaborates with Tenova HYL Technologies
Gametofitos y esporofitos de Dryopteris wallichiana (Spreng.) Hyl. (Dryopteridaceae-Pteridophyta).
Bibliografia Botanica Iberica, 2008 Pteridophyta
Vilma and Joseph Hyl, Alice and Maurice Moore; family$50
A lesson in change for giving students
Starting this month, ESI plans to send Emirati employees on a training program in the area of iron ore direct reduction, at Mexican based Tenova HYL, a strategic partner of ESI and Danieli.
ESI sales revenue up by 135pc
Spread of ampicillin/vancomycin-resistant Enterococcus faecium of the epidemic-virulent clonal complex-17 carrying the genes esp and hyl in German hospitals.
Vancomycin-resistant enterococci outbreak, Germany, and calculation of outbreak start
It has three unit of DRI plant namely HYL I, HYL II and HYL III.
Profile of steel industry in Indonesia

Medical browser ?
Full browser ?