Hyl


Also found in: Acronyms, Encyclopedia.

Hyl

Symbol for hydroxylysine or hydroxylysyl (5Hyl specifically refers to 5-hydroxylysine).
References in periodicals archive ?
PCR primers, annealing temperatures, and product sizes for the detection of virulence genes virulence primers product size gene (bp) gelE AAT TGC TTT ACA CGG AAC GG 548 GAG CCA TGG TTT CTG GTT GT acm GGC CAG AAA CGT AAC CGA TA 353 CGC TGG GGA AAT CTT GTA AA hyl ACA GAA GAG CTG CAG GAA ATG 276 GAC TGA CGT CCA AGT TTC CAA esp AGA TTT CAT CTT TGA TTC TTG G 510 AAT TGA TTC TTT AGC ATC TGG efaA CACGCTATTACGAACTATGA 375 TAAGAAAGAACATCACCACGA cyl TGG ATG ATA GTG ATA GGA AGT 517 TCT TTC ATC ATC TGA TAG TA virulence annealing gene temperature reference ([degrees]C) gelE 52 [17] acm hyl esp 55 efaA [18] cyl Table 2.
faecalis; gelE, extracellular metalloendopeptidase (gelatinase) for both species; hyl, hyaluronidase for both species; cylA, activation of cytolysin (hemolysin/class I.
The HyL process involves the batch reduction of iron ore in retorts by reformed natural gas.
Its sponge iron factory has only HYL I and HYL III modules remaining in operation.
Besides, Papyrus Amherst 63 in Demotic script distinguishes h and h, for instance in hyl, "force," but slh, "to send"; or hmr, "wine," but lhm, "bread.
Its sponge iron factory (Direct Reduction Plant) used gas based technology with direct reduction process of Hyl from Mexico.
hyl will face either Bangor City or Caernarfon in the two-legged semi-final.
263); the roots hwl and hyl are not synonyms as they mean, respectively, "to frighten, scare" and "to pour, strew.
Design and construction for the new facility has begun, and if construction is funded, the project will be completed in hYl 4/15.