herpetology

(redirected from Herptile)
Also found in: Dictionary, Thesaurus, Wikipedia.
Related to Herptile: herpetofauna

her·pe·tol·o·gy

(her'pe-tol'ŏ-jē),
The branch of zoology concerned with the study of reptiles and amphibians.

herpetology

(hûr′pĭ-tŏl′ə-jē)
n.
The branch of zoology that deals with reptiles and amphibians.

her′pe·to·log′ic (-tə-lŏj′ĭk), her′pe·to·log′i·cal adj.
her′pe·to·log′i·cal·ly adv.
her′pe·tol′o·gist n.

herpetology

the study of reptiles.
References in periodicals archive ?
We call attention to the variety of survey techniques that were necessary to characterize the species richness and diversity in El Monte Valley, a finding with important implications for monitoring herptile communities in sensitive habitats.
Objectives : The objective of the SemiAquaticLife project is to restore and improve the conservation status of herptiles and semi-aquatic insects in Natura 2000 sites in southern Sweden (11 sites), Denmark (19 sites) and Germany (9 sites).
The best explanation for the presence of most of the above species of plants, invertebrates and herptiles in relative isolation in the Olive Highlands is that they represent relicts of more widespread populations that flourished in the more mesic climate of an earlier time, perhaps as recently as ca.
Sand Bars are highly ranked because they serve as important nesting sites for several endangered herptiles. Another 37% of the area includes communities that are vulnerable to degradation (S3).
Fungi/Lichens 6 Protista 3 Plantae 5 Animalia 36 The Animalia set includes 10 fish surveys, 7 of birds, 1 of herptiles, 10 of insects, 2 of crustaceans, 1 of molluscs, 4 of invertebrates," and 1 of "macrofauna." The Plantae set has 3 herbaceous plant surveys, 1 of trees and 1 of mosses.
As this book makes clear, induced defenses are everywhere one looks, among algae, higher plants, microbes, solitary and colonial aquatic and marine invertebrates, herptiles, fish, and mammals (at least).
1995) using a light strand primer (5[prime] TCACCCTTAACTCCCAAAGC 3[prime]) based on a consensus of tRNA-pro sequences for herptiles and fishes (Kessing et al.
Bobcats are known to consume a variety of prey items including rodents, herptiles and other carnivores, but lagomorphs are key prey across bobcat range, and deer (Odocoileus spp.), as prey and carrion, are important food sources during winters in northern latitudes (Hunter, 2011).