HPRT


Also found in: Acronyms.

HPRT

Hypoxanthine-guanine phosphoribosyl transferase, see there.
References in periodicals archive ?
Table 1: Sequences of primers used for qRT-PCR amplification of transcripts of interest Gene name Primer forward (5' to 3') Primer reverse (5' to 3') BDNF EXON I TGTTGGGGAGACGAGATTTT CGTGGACGTTTGCTTCTTTC BDNF EXON III CTGAGACTGCGCTCCACTC GTGGACGTTTGCTTCTTTCA BDNF EXON IV GAGCAGCTGCCTTGATGTTT GTGGACGTTTGCTTCTTTCA BDNF EXON IX GTGACAGTATTAGCGAGTGGG GGGTAGTTCGGCATTGC HPRT CCCAGCGTCGTGATTAGTGA TGGCCTCCCATCTCCTTCAT GAPDH CGTGATCGAGGGCTGTTGG CTGCTTCAGTTGGCCTTTCG
We believe that the neural aberrations of HPRT deficiency are the consequence of these combined, multi-system metabolic errors.
In the pooled data, the median HPRT mutation frequencies for actively and passively smoking morns was identical at 0.
The aircraft will carry two HPRTs hooked into the SIRFC system.
The gene HPRT is named for the enzyme it encodes, hypoxanthine-guanine phosphoribosyltransferase.
Somatic cell mutation frequency at the HPRT, t-cell antigen receptor and glycophorin A loci in Cockayne syndrome.
This gene is known as the HPRT gene, and it is responsible for creating the enzyme hypoxanthine phosphoribosyl transferase.
Initial tests showed that transcript abundance for HPRT in adipose and liver tissue was similar between control and treatment group offspring (p > 0.
Of five selected reference genes (Figure 3), abundance of ACTB and HPRT was slightly higher at 1.
De acuerdo al convenio UNMSM-MINSA-JICA, tanto docentes de la Facultad de Medicina como profesionales del MINSA debian recibir entrenamiento en el HPRT de la Universidad de Harvard mediante una pasantia, para lo cual existian 50 vacantes.
An open-label prospective study of allopurinol combined with low-dose thiopurine therapy showed increased HPRT activity (9).
Grant, associate professor of environmental and occupational health at Pitt's Graduate School of Public Health, discovered evidence of abnormalities in the HPRT gene located on the X chromosome in cord blood from newborns of non-smokers exposed to environmental tobacco smoke.