ONECUT1

(redirected from HNF6)
Also found in: Acronyms.

ONECUT1

A gene on chromosome 15q21.3 that encodes a homeobox-type transcription activator, which binds to specific DNA sequences and stimulates expression of target genes.
References in periodicals archive ?
(a-f) qRT-PCR demonstrated elevated expression of insulin, glucagon, HNF6, islet-1, Nkx6.f and PDX-1 on day 21 compared with day 14 and undifferentiated iPSCs.
Gene GenBank Primer accession number GAPDH NM_000072.6 Forward primer AAGAAGGTGGTGAAGCAGG Reverse primer GAAGGTGGAAGAGTGGGAGT Insulin NM.000085.6 Forward primer AGTTGAGTTGGGCAGAATAGG Reverse primer TCCAAAGGGCACCGTAT Glucagon NM.000068.7 Forward primer CCAGCGACTACAGCAAATACC Reverse primer GAGAAGGAGCCATCAGCGT HNF6 NM_000075.6 Forward primer CGTTACAGCATCCCACAG Reverse primer AGCCACTTCCACATCCTC Nkx6.1 NM.144955.2 Forward primer GAAAACACACCAGACCCA Reverse primer GGAACCAGACCTTGACCT Islet-1 NM.021459.4 Forward primer CACCTTGCGGACCTGCTAT Reverse primer AGGGCGGCTGGTAACTTTG Pdx-1 NM_008814.3 Forward primer CGGAACCCGAGGAAAACA Reverse primer CGAGGTCACCGCACAATCT
Our study has shown differentiated effects of dalarelin and cetrorelix on the expression of selected transcription factors, namely: STAT5b, HNF4[alpha] and HNF6. Signal transducer and activator of transcription 5b is thought to be the main transcription mediator of sex-dependent effects of the GH in the liver, due to its stimulatory effects on male-specific genes and inhibitory effects on female-specific genes.
In addition to STAT5b, liver-enriched transcription factors HNF4[alpha] and HNF6 are also crucial for the GH- and sex-dependent liver gene expression.
Hepatocyte nuclear factor 4[alpha] is generally known as the positive regulator of "male" CYP2C11 expression whereas HNF6 is known as the positive regulator of "female" CYP2C12, and negative of "male" CYP2A2 expression.