List of primers used for quantitative real-time polymerase chain reaction Gene (ID) Primer sequence 5'-3' GAPDH F: AGGTCGGTGTGAACGGATTTG XM_017321385.1 R: TGTAGACCATGTAGTTGAGGTCA Caspase-3 F: AGCAGCTTTGTGTGTGTGATTCTAA XM_017312543.1 R: AGTTTCGGCTTTCCAGTCAGAC BAX F: CAGGATGCGTCCACCAAGAA XM_01 1250780.2 R: GCAAAGTAGAAGAGGGCAACCA PCNA F: TAAAGAAGAGGAGGCGGTAA NM_01 1045.2 R: TAAGTGTCCCATGTCAGCAA Cyclin B1 F: AGATGCAGTTGGCACCATGT NM_172301.3 R: TTCGACAACTTCCGTTAGCCT Annealing Fragment temperature Gene (ID) length (bp) ([degrees]C) GAPDH XM_017321385.1 123 60 Caspase-3 XM_017312543.1 137 60 BAX XM_01 1250780.2 197 60 PCNA NM_01 1045.2 175 60 Cyclin B1 NM_172301.3 148 60 GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; BAX, Bcl-2-associated X protein; PCNA, proliferating cell nuclear antigen.
Primer sequences Gene Sequence Accession No Tm ([degrees]C) 16S rRNA TCCTACGGGAGGCAGCAG (*) - 61 GGACTACNAGGGTATCNA (**) GAPDH TTGCCCTCAACGACCACTTT J02642 60 TGGTCCAGGGGTCTTACTCC Gene Product size 16S rRNA 245 GAPDH 120 Tm: Temperature GAPDH:
glyceraldehyde-3-phosphate dehydrogenase (*) Universal forward primer used by Nadkarni et al.
Glyceraldehyde-3-phosphate dehydrogenase mRNA levels might be regulated under common situations, and in some cases, gapdh could be inappropriate as a reference gene for some experimental conditions.
AICAR: 5-amino-4-imidazolecarboxamide riboside-1-b-D-ribofuranoside; Egr1: early growth response factor 1; p-AMPK[alpha]: phosphorylated adenosine monophosphate-activated protein kinase a; AMPK[alpha]: adenosine monophosphate-activated protein kinase a; GAPDH:
glyceraldehyde-3-phosphate dehydrogenase.
Caption: Figure 2: Protein levels of vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and pigment epithelium-derived factor (PEDF) measured through Western blotting and normalized to the
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level.
B2M: [beta]-2-microglobulin; CLDN5: claudin 5; CTNNB1: catenin-[beta]1; DENV: dengue viral RNA; EIF2AK2: eukaryotic translation initiation factor 2-alpha kinase 2; GAPDH:
glyceraldehyde-3-phosphate dehydrogenase; IFITM1: interferon-induced transmembrane protein 1; IFN-[beta]: interferon-[beta]; IL-6: interleukin-6; ISG15: interferon-stimulated gene 15; JAM-3: junctional adhesion molecule 3; OCLN: occludin; PPIA: peptidylprolyl isomerase A; RSAD2: radical SAM domain-containing 2 (viperin); TBP: TATA-binding protein; TNF-[alpha]: tumor necrosis factor-[alpha]; ZO-1: zonula occludens 1.
Expression levels were normalized with
glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
All samples were studied in triplicate and the mRNA abundance was normalized for each sample to the amount of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
The coenzyme reduces in the
glyceraldehyde-3-phosphate dehydrogenase reaction, and the resulting NADH oxidizes in the LDH reaction at mean rate of 2-4 mmol per liter of packed RBCs per h (mmol/[l.sub.RBCs] x h).
The primers were designed by Primer Express [sup][R] v.2.0 software (Applied Biosystems, Foster City, CA, USA), using
glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) as a housekeeping control gene.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been considered a classical cytosolic glycolytic protein and in some microorganisms plays some role in cell flocculation (8).
Kim et al., "Oxidative modifications of
glyceraldehyde-3-phosphate dehydrogenase play a key role in its multiple cellular functions," Biochemical Journal, vol.