glyceraldehyde 3-phosphate

(redirected from Glyceraldehyde-3-phosphate)
Also found in: Acronyms.

glyc·er·al·de·hyde 3-phos·phate

(glis'ĕr-al'dĕ-hīd fos'fāt),
An intermediate in the glycolytic breakdown of d-glucose; one of the products of the splitting of fructose 1,6-bisphosphate under the catalytic influence of fructose-bisphosphate aldolase.

glyceraldehyde 3-phosphate (GALP)

see PGAL.
References in periodicals archive ?
Glyceraldehyde-3-phosphate dehydrogenase is also well ranked in the flat oyster Ostrea edulis.
SIRT1: sirtuin 1; Egr1: early growth response factor 1; p-AMPK[alpha]: phosphorylated adenosine monophosphate-activated protein kinase [alpha]; AMPK[alpha]: adenosine monophosphate-activated protein kinase [alpha]; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Primer's sequence (5'-3') Amplicon Target (forward and reverse) and length (bp) size (bp) VEGF (F) AGATCGAGTACATCTTCAAGCCATC (25) 66 (R) CGTCATTGCAGCAGCCC (17) bFGF (F) CCGACGGCCGAGTTGAC (17) 112 (R) TAACGGTTAGCACACACTCCTTTG (24) PEDF (F) CGACCAACGTGCTCCTGTCT (20) 131 (R) GATGTCTGGGCTGCTGATCA (20) GAPDH (F) CATCCATGACAACTTTGGTATCGT (24) 74 (R) CAGTCTTCTGGGTGGCAGTGA (21) VEGF: vascular endothelial growth factor; bFGF: basic fibroblast growth factor; PEDF: pigment epithelium-derived factor; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Relative levels of C3 and TGF-[beta]1 mRNA transcripts to glyceraldehyde-3-phosphate dehydrogenase in cultured blood cells were determined by quantitative reverse transcriptase polymerase chain reaction.
Primers used in real time polymerase chain reaction (PCR) analysis of SH-SY5Y cells Primer name Forward primer sequence (5'-3') Bax TGGAGCTGCAGAGGATGATTG Bcl-2 CATGTGTGTGGAGAGCGTCA Caspase 3 ATTGTGGAATTGATGCGTGA Caspase 9 GCTGTTCAGGCCCCATATGAT Akt-1 CTTCTTTGCCGGTATCGTGT mTOR CTCATCAGCATTAATAATAAGC DJI GGAGACGGTCATCCCTGTAG GAPDH (housekeeping) GAAGGTGAAGGTCGGAGTCA Primer name Reverse primer sequence (3'-5') Bax GAAGTTGCCGTCAGAAAACATG Bcl-2 TCACTTGTGGCCCAGATAGG Caspase 3 GGCAGGCCTGAATAATGAAA Caspase 9 GGACTCACGGCAGAAGTTCA Akt-1 CTGGCCGAGTAGGAGAACTG mTOR GTGTCCATTTTCTTGTCATAG DJI TTCACAGCAGCAGACTCAGA GAPDH (housekeeping) GACAAGCTTCCCGTTCTCAG GAPDH: glyceraldehyde-3-phosphate dehydrogenase; mTor: mechanistic target of rapamycin
The mean optical density value of each protein band relative to that of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) band from the same sample was calculated.
To perform the real-time RT-PCR the primer pairs (Actin_SYBR_F: 5'-AGG CAC CAG GGC GTG AT-3'; Actin_SYBR_R: 5'-GCC CAC ATA GGA ATC CTT CTG AC-3' and GAPDH_SYBR_F: 5'-CCA GGT GGT CTC CTC TGA CTT C-3'; GAPDH_SYBR_R: 5'-CAA AGT GGT CGT TGA GGG CAA TG-3') were used to amplify the cellular ACTB (beta-actin) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) genes, respectively.
To assess an appropriate housekeeping gene that is stably expressed across different tissues, gender, and gonad of Yellow River carp at various developmental stages, six reference genes (beta-2 microglobulin (B2M), beta-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor 1 alpha (EF-1a), 18S ribosomal RNA (18S rRNA), and 40S ribosomal protein (40S)) were evaluated using descriptive analysis and three software programs (geNorm, BestKeeper, and NormFinder), along with RNA-seq statistics.
The primers were designed by Primer Express [sup][R] v.2.0 software (Applied Biosystems, Foster City, CA, USA), using glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) as a housekeeping control gene.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as a control with primers of 5'-GAGTCAACGGATTTGGTCGT (forward) and 5'TGTGGTCATGAGTCCTTCCA (reverse).
After protein identification by mass spectrometry, we found an unnamed protein product (homologous to glyceraldehyde-3-phosphate dehydrogenase) with similar ranges of Mr and pI (Table 1).
The expression level of each gene at every checkpoint was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression.