genomic library


Also found in: Dictionary.
Related to genomic library: CDNA library, nucleic acid probe

ge·nom·ic li·brar·y

library in which both introns and exons are represented; a library prepared from genomic DNA.

genomic library

a collection of DNA clones which, together, represent the entire GENOME of an ORGANISM.
Mentioned in ?
References in periodicals archive ?
In accordance with the FIASCO protocol (Zane et al., 2002), we constructed a partial genomic library and used 5'-biotinylated (AAAC)8 oligonucleptide probe for enrichment selection from it.
A higher resolution (about 0.05 cM) of the molecular map around the gene will be attained with the screening of a 2000 individual segregating population with AFLP markers Besides, a BAC genomic library and a cosmid library will be creened in order to identify clones positive for the markers linked to Ry to start the chromosome walking in the region and to find a BAC clone which contain molecular markers placed at both sides of the gene
Genomic library: A collection of biomolecules made from DNA fragments of a genome that represent the genetic information of an organism that can be propagated and then systematically screened for particular properties.
1996) M1 (B20 locus) R: GTGTGTTGCGGAATCGAA From a genomic library constructed using ovary DNA (Garcia & Alcivar-Warren 2007) TUGAPv1-3.132 F: CCGCCATCATCATCAACA R: TCATTCGGGTTCGAGACTC TUGAPv3-5.213 F: CCCAGAACCATGTGATTGC R: GTGAAGGGGGAATTATCCA TUGAPv1-3.271 F: CCACCCAACGTTTAAATAAC R: GTCAGAGGATTGTATGATGT TUGAPv7-9.94 F: GCGCTGTCCTGTTATGTGAAAG R: CACAGACAACCCGAAAGCTAAA TUGAPv7-9.95 F: GATCCTGCGAGTCACTTTATCTC R: TTTATTGCGTATCCCAGAAGC TUGAPv7-9.179 F: GCTGTCTGGCAGTCATTAA R: TGAGGAAAGGATGGCTGAA From genomic libraries ovary DNA (Meehan et al.
SSR information was obtained from two different sources: 46 SSRs were collected from a conventional genomic library (genomic SSRs) developed at IPK Gatersleben by Roder et al.
A salamander genomic library in lambda phage was screened using the polymerase chain reaction (PCR) to identify the phage clone(s) containing the green rod photoreceptor gene.
lophii genomic library was prepared as follows: The [greater than] 2 kb fraction of a complete Eco-RI digest of 10 [[micro]gram] of genomic DNA was isolated from a 1% agarose gel with a Gene-Clean II kit.
semilaevis were searched from the genomic library, and other species genomic sequences of DNAH9 were obtained from Ensemble (http://www.ensembl.org/index.html) and NBCI (Coelacanth: ENSLACG00000003371; Danio rerio: ENSDARG00000103383; Fugu rubripes: ENSTRUG00000000064; Lampetra japonica: ENSPMAG00000005143; Maylandia zebra: NW_004532118.1; and Xiphophorus maculatus: NW_005372467.1).
ARS takes a coordinated approach to research in emerging diseases, using a wide array of techniques, from studying signs of infection to building a genomic library of a disease-causing agent.
A putative operon for jenseniin G production was located by screening a genomic library of P.

Full browser ?