A gene on chromosome 12p12.2 that encodes liver glycogen synthase, which catalyses the rate-limiting step in glycogen synthesis—the transfer of a glucose residue from uridine diphosphate (UDP) glucose to a terminal branch of a glycogen chain.

Molecular pathology
Defects of GYS2 cause glycogen storage disease type 0.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
The primer sequences for real-time quantitative polymerase chain reaction analysis Genes Primer sequences Product GeneBank (5'[right arrow]3') size (bp) Identification GAPDH F:GAGGGTAGTGAAGGCTGCTG 113 NM_204305 R:CATCAAAGGTGGAGGAATGG GLUT3 F:ATGCTCTTCCCCTATGCTGA 123 NM_205511 R:AAAAGTCCTGCCCTTGGTCT GLUT8 F:GCAAGGGGTGTATCAAGCAG 126 NM_204375 R:GGCAGAGAAGAGCCAGAATG PYG F:CTTTGGGATGAGGGTGGAG 105 NM_204392.1 R:ATCTGGTCAACTGCCTGCTT GYS2 F:ATCGCCTTCTGTCTCTCAGC 108 XM_015291547.1 R:TTTTGCCTATCCCTTTCAGC GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLUT3, glucose transporter 3; GLUT8, glucose trans-porter 8; PYG, glycogen phosphorylase; GYS2, glycogen synthase.