(redirected from GRP1)
Also found in: Acronyms.


A gene on chromosome 7p22.1 that encodes cytohesin 3, a member of the PSCD family, which regulate protein sorting and membrane trafficking. CYTH3 is involved in controlling Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation-factor protein (ARF6) functions, in addition to acting on ARF1.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Para la construccion del segundo plasmido se removio el promotor 35S del vectorpBIN61 con la enzima EcorI, para clonar en aquel sitio la secuencia hibrida GRP1.8-PAMEH obtenida por PCR de extension por solapamiento, el cual consistio en amplificar independientemente el promotor GRP1.8 usando los iniciadores EcoRV-GRP1.8 Fw: GATATCGCTTCCCTCTTAGG y GRP1.8 Rv: GTAGTTTGTTTATTTTTATCCCACTTAAAG y el gen optimizado sshpmeh usando los iniciadores GRP1.8_ PVA_SP_PAME Fw: CTTTAAGTGGGATAAAAATAAACAAAC y EcoRV_PAME Rv: GATATCCACCTTATTGGGCG y luego unirlas en una segunda reaccion de PCR usando los iniciadores EcoRV-GRP1.8 Fw y EcoRV_PAME Rv (Sambrook & Russel 2006), a este segundo plasmido se le denomino pGRP_PAMEH (Fig.
35S, promotor del virus del mosaico de la coliflor 35S; GRP1.8, promotor especifico de xilema; PVA enhancer, potenciador de la traduccion; GRP signal peptide, senal para exportacion de la proteina hacia el espacio extracelular; nptII gen neomicina fosfotransferasa II; LR borde derecho; LB, borde izquierdo.
Specifically, the thrips-resistance QTL on LG b03 was linked to a gene for a pathogen related protein (PvPR-1) and to several genes for glycine-rich proteins (GRP1.8-1 and GRP1.8-2).