A gene on chromosome 2p16 that encodes an orphan G protein-coupled receptor.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Among them, GPR75 had the highest expression level followed by CCR1 and CCR5.
Gene Forward (5' [right arrow] 3') Cxcr2 atccaccttgaattctcccatc Il6ra cctctgacttccatttctgct Cxcr1 tcccgtgatatttccaaattctttc Ccr3 ggtgcccactcatattcatagg Ccr5 gtgctgacataccataatcgatg Ccr1 aggaactggtcaggaataatagc Gpr75 tcaggatctcagctcacaga Ccr2 actgaggtaacatattattgtcttcca Cx3cr1 cacaatgtcgcccaaataacag Cyclophilin tggagagcaccaagacagaca Gene Reverse (5' [right arrow] 3') Product length (bp) Cxcr2 gcctcactttcttccagttca 145 Il6ra caagaatcctcgtccatgtcc 118 Cxcr1 tcccgcacacaaggaac 120 Ccr3 ctactggactcataaaggacttagc 125 Ccr5 tgtcttcatgttagatttgtacagc 147 Ccr1 caaaggcccagaaacaaagtc 125 Gpr75 agatagggtcactactgcga 102 Ccr2 gagccatacctgtaaatgcca 148 Cx3cr1 tcccttcccatctgctca 112 Cyclophilin tgccggagtcgacaatgat 66 Table 2: Cytokines/chemokines receptors name and its ligands.