GC content

(redirected from GC-content)
Also found in: Wikipedia.

GC con·tent

the amount of guanine and cytosine in a polynucleic acid usually expressed in mole fraction (or percentage) of total bases; the melting temperature of such biopolymers varies with the GC content.

GC content

The percentage of nitrogenous bases on double-stranded DNA which is either guanine and cytosine, a datum of interest to molecular biologists as guanine and cytosine bind to each other with 3 hydrogen bonds (in contrast to adenine and thymine, which share 2 hydrogen bonds), and thus is a benchmark of molecular stability.
References in periodicals archive ?
The sequence of the IFNAR1 primer (Thermo-scientific Inc, US) is as follows: 5' GGAACAGGAGCGATGAGTCT 3'; guanine-cytosine (GC)-content =55%; temperature (TM) =59.18degC; length =235 and R1 IFNAR1: 5' TGAGCTTTGCGAAATGGTGT 3'; GC-content =45 %; TM= 58.68degC; length =235.
Orphelia [20, 21] integrates monocodon and dicodon usage, sequence patterns around translation initiation sites (TISs), open reading frame (ORF) length, and GC-content to represent the ORF fragments, then inputting into an artificial neural network to estimate the probability that a given ORF encodes a protein.
The monoamino acid usage is the 21 amino acid (20 amino acids plus one "STOP" codon) frequencies occurring in the DNA sequences, some of which are linearly related to the GC-content of the genome [48] and are important in discriminating coding and noncoding DNA sequences [22].
Orphelia [21, 22] firstly extracts the features of monocodon usage, dicodon usage, and translation initiation sites by building linear discriminants and then combines these features with ORF length and GC-content by using an artificial neural network to estimate the probability of an ORF encoding a protein.
This bias is in part dependent on the GC-content of each sequenced region (28).
These experiments allowed us to determine that the most important technical factor affecting the performance of the assay was the number of TACS on different chromosomes that exhibited similar GC-content characteristics, thus allowing for more robust GC-bias correction.
Amino acid usage in proteins depends on the GC-content of corresponding genes [15].
Four of those bacterial species have genomic GC-content lower than 40% (Borrelia burgdorferi, Clostridium perfringens, Francisella tularensis, and Staphylococcus aureus).
Frequencies of those amino acid residues in proteomes which are encoded by GC-rich codons (Ala, Gly, Pro, and Arg) show direct dependence on GC-content of genomes [10].
Even though three amino acids most frequently involved in [Mn.sup.2+] binding (Asp, Glu, and His) are encoded by codons of average GC-content, their binding features and patterns of secondary structure distribution around them may depend on GC-content of genes.
The first set includes 39 PDB files with 3D structures of proteins from bacteria with genomic GC-content lower than 40%.
Use of pyrazolopyrimidine-modified oligonucleotides can eliminate self-association in primers and probes with high GC-content. This technology allows Nanogen to develop highly sensitive amplification-based diagnostic assays, solving a serious limitation in the traditional design of assays.