Also found in: Acronyms.


A gene on chromosome 12p13 that encodes glyceraldehyde-3-phosphate dehydrogenase, which has both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities. It catalyses the reversible
oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide, an important energy-yielding step in carbohydrate metabolism. GADPH participates in nuclear events, including transcription, RNA transport, DNA replication and apoptosis.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
List of primers used for quantitative real-time polymerase chain reaction Gene (ID) Primer sequence 5'-3' GAPDH F: AGGTCGGTGTGAACGGATTTG XM_017321385.1 R: TGTAGACCATGTAGTTGAGGTCA Caspase-3 F: AGCAGCTTTGTGTGTGTGATTCTAA XM_017312543.1 R: AGTTTCGGCTTTCCAGTCAGAC BAX F: CAGGATGCGTCCACCAAGAA XM_01 1250780.2 R: GCAAAGTAGAAGAGGGCAACCA PCNA F: TAAAGAAGAGGAGGCGGTAA NM_01 1045.2 R: TAAGTGTCCCATGTCAGCAA Cyclin B1 F: AGATGCAGTTGGCACCATGT NM_172301.3 R: TTCGACAACTTCCGTTAGCCT Annealing Fragment temperature Gene (ID) length (bp) ([degrees]C) GAPDH XM_017321385.1 123 60 Caspase-3 XM_017312543.1 137 60 BAX XM_01 1250780.2 197 60 PCNA NM_01 1045.2 175 60 Cyclin B1 NM_172301.3 148 60 GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BAX, Bcl-2-associated X protein; PCNA, proliferating cell nuclear antigen.
PCR bands of LC3 and p62 were normalized using GAPDH. The result is presented in Table 2 and Figure 5.
Primer sequences Gene Sequence Accession No Tm ([degrees]C) 16S rRNA TCCTACGGGAGGCAGCAG (*) - 61 GGACTACNAGGGTATCNA (**) GAPDH TTGCCCTCAACGACCACTTT J02642 60 TGGTCCAGGGGTCTTACTCC Gene Product size 16S rRNA 245 GAPDH 120 Tm: Temperature GAPDH: glyceraldehyde-3-phosphate dehydrogenase (*) Universal forward primer used by Nadkarni et al.
Data were obtained by real-time PCR and the results are reported as means [+ or -] SE relative to GAPDH (n=6 in each group).
Stability analysis using the geNorm, NormFinder, and BestKeeper methods indicated that GAPDH is the most suitable reference gene for drought stress studies in sugarcane; however, the [beta]-act gene showed satisfactory levels of stability (Table 4).
Therefore, in the current study to investigate flavonoids as inhibitors of GAPDH enzyme of T.
Eight commonly used reference genes were selected in this study (Table 1): NADH dehydrogenase subunit 4 (nd4), gapdh, cox1, rps27, tif5a, rps4, act, and 18S.
(a) Hepatic and subcutaneous adipose tissue GDF15 expression in obese patients determined by qPCR and normalised to GAPDH. (b, c) Hepatic (b) and subcutaneous adipose tissue (c) GDF15 expression in obese patients before and 6 months after LAGB determined by qPCR and normalised to GAPDH.
The relative expression value ([2.sup.-[DELTA]Cq]) was obtained by normalization, subtracting the arithmetic mean of the [beta]-actin and gapdh reference genes from each gene of interest [45].
Total RNA was prepared from cells using the RNeasy plus mini kit (Qiagen), according to the manufacturer's instructions, with the following sequence-specific primers: RAGE, 5'-GAAAGCCCTCCTGTCAGCATC-3' and 5'-GGCACCATTCTCTGGCA TCTC-3'; TLR-2, 5' -CTTCCAGGTCTTCAGTCTTC-3' and 5'-TGA TTGCGGACACATCTC-3'; TLR-4, 5'-GCCGTTGGTGTATCTTTG-3' and 5'-GCTGTTTGCTCAGGATTC-3'; and GAPDH, 5'-ATCACTGCCACCC AGAAG-3' and 5'-TCCACGACGGACACATTG-3'.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was found to be stably expressed in plasma and was regarded as an ideal internal control.