GAPDH

(redirected from GAPD)
Also found in: Acronyms.

GAPDH

A gene on chromosome 12p13 that encodes glyceraldehyde-3-phosphate dehydrogenase, which has both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities. It catalyses the reversible
oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide, an important energy-yielding step in carbohydrate metabolism. GADPH participates in nuclear events, including transcription, RNA transport, DNA replication and apoptosis.
Mentioned in ?
References in periodicals archive ?
Gene Primers Amplicon size PPARG 5' GCAAAGGCGAGGGCG 3' 5' CCCATCATTAAGGAATTCATGTCAT 3' 82 bp 5' FAM CAGACAAATCACCATTCG MGB 3' GAPD 5' GGAAGGTGAAGGTCGGAGTCA 3' 5' CTGGAAGATGGTGATGGGATTTC 3' 229 bp 5' VIC TCAGCCTTGAGGGTGC MGB 3' Note: bp: base par.
To amplify cDNA reverse transcribed from 104 cells, we used TagMan Universal PCR Master Mix (Applied Biosystems) according to the manufacturer's instruction and inventoried TagMan assays Hs00605631-gl for Try-1, HS00234422-m1 for MMP2, Hs00159163 m1 for MMP7, Hs00234579 m1 for MMP9, Hs00170182 m1 for uPA, Hs00182181 m1 for uPAR, Hs00179887 m1 for MSH2, Hs99999905 m1 for GAPD (as an external standard), and GAPD endogenous control (VIC/TAMRA Probe).
The interassay CV of the TagMan assay was 15%-45% with GAPD as an external standard and 10%42% with GAPD multiplexing.
When we analyzed 8 replicate FFPE samples with 2 ng of gDNA as an internal standard, we observed expression above the detection limit (cDNA:gDNA ratio, >0.1) for GAPD, Try, MMP7, MMP9, uPA, and uPAR, whereas MMP2 and MSH2 were expressed below the detection limit.
Distinct patterns of gene expression were observed in different anatomic regions: GAPD was consistently highly expressed in all regions.
Healthy colonic mucosa displayed high expression of GAPD and low expression of the rest of the analyzed genes.
[3] Nonstandard abbreviations: IVT, in vitro transcription; aRNA, antisense RNA; SMART, switching mechanism at the 5' end of the RNA transcript; dsDNA, double-stranded DNA; Ct, threshold cycle; Gapd, Mus musculus glyceraldehyde dehydrogenase gene; UTR, untranslated region; and Pbgd, Mus musculus porphobllinogen deaminase gene.