(redirected from GADD153)


A gene on chromosome 12q13.1-q13.2 that encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors, which form heterodimers with other C/EBP members—e.g., C/EBP and LAP—preventing their DNA binding activity. DDIT3 is activated by endoplasmic reticulum stress, and plays roles in adipogenesis, erythropoiesis and apoptosis.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
Chang et al., "GADD153 mediates berberine-induced apoptosis in human cervical cancer Ca ski cells," Anticancer Research, vol.
Ron, "Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP kinase," Science, vol.
Quantitative RTPCR was performed using primers specific for C/EBP homologous protein (CHOP)/growth arrest and DNA damage 153 (GADD153) (GGCAGCTGAGTCATTGCC and GCAGATTCACCATTCGGTCA), glucose-regulated protein-78 (GRP78) (CCTAGCTGTGTCAGAATCTCCAT CC and GTTTCAATGTCACCATCCAAGATCC), Beclin-1 (CCAGATGCGTTATGCCCAGAC and CATTCCATTCC ACGGGAACAC), microtubule-associated protein 1 light chain 3B (MAP1LC3B) (ACGCATTTGCCATCACAGTTG and GGGACCTTCAGCAGTTTACAGTCAG), and [beta]-actin (CATCCGTAAAGACCTCTATGCCAAC and ATGGAG CCACCGATCCACA).
Muller et al., "Expression and function of C/EBP homology protein (GADD153) in podocytes," The American Journal of Pathology, vol.
Holbrook, "Physical and functional association between GADD153 And CCAAT/enhancer-binding protein during cellular stress," The Journal of Biological Chemistry, vol.
Holbrook, "Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bc12 and perturbing the cellular redox state," Molecular and Cellular Biology, vol.
These studies suggested that preventive mitochondrial protection might delay the onset of POAG in patients carrying the MYOC mutation, P370L.[sup][4] CHOP (also called GADD153 or DDIT3 ) encodes a member of the CCAAT/enhancer-binding proteins, which is a family of transcription factors.[sup][5] The CHOP protein is activated by endoplasmic reticulum (ER) stress and the mitochondrial unfolded protein response and can promote apoptosis.
DDIT3, also known as GADD153 or CHOP, encodes a transcription factor belonging to the C/EBP family.
Increased GADD153 gene expression during iron chelation-induced apoptosis in Jurkat T-lymphocytes.
Oxidative stress in the endoplasmic reticulum activates protein transcription factor Gadd153, a protein that sensitizes cells to endoplasmic reticulum stress and produces reactive oxygen species through setting up.
Habener, "Transcription factors C/EBPa, C/EBP^, and CHOP (Gadd153) expressed during the differentiation program of keratinocytes in vitro and in vivo," Journal of Investigative Dermatology, vol.
Gulbins, "Fas- or ceramide-induced apoptosis is mediated by a Rac1-regulated activation of Jun N-terminal kinase/p38 kinases and GADD153," Journal of Biological Chemistry, vol.