DDIT3

(redirected from GADD153)

DDIT3

A gene on chromosome 12q13.1-q13.2 that encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors, which form heterodimers with other C/EBP members—e.g., C/EBP and LAP—preventing their DNA binding activity. DDIT3 is activated by endoplasmic reticulum stress, and plays roles in adipogenesis, erythropoiesis and apoptosis.
Mentioned in ?
References in periodicals archive ?
Chang et al., "GADD153 mediates berberine-induced apoptosis in human cervical cancer Ca ski cells," Anticancer Research, vol.
Studies on the Dual Cytotoxicity and Antioxidant Properties of Berberis vulgaris Extracts and Its Main Constituent Berberine
Ron, "Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP kinase," Science, vol.
The Effect of Chronic Inflammation and Oxidative and Endoplasmic Reticulum Stress in the Course of Metabolic Syndrome and Its Therapy
Quantitative RTPCR was performed using primers specific for C/EBP homologous protein (CHOP)/growth arrest and DNA damage 153 (GADD153) (GGCAGCTGAGTCATTGCC and GCAGATTCACCATTCGGTCA), glucose-regulated protein-78 (GRP78) (CCTAGCTGTGTCAGAATCTCCAT CC and GTTTCAATGTCACCATCCAAGATCC), Beclin-1 (CCAGATGCGTTATGCCCAGAC and CATTCCATTCC ACGGGAACAC), microtubule-associated protein 1 light chain 3B (MAP1LC3B) (ACGCATTTGCCATCACAGTTG and GGGACCTTCAGCAGTTTACAGTCAG), and [beta]-actin (CATCCGTAAAGACCTCTATGCCAAC and ATGGAG CCACCGATCCACA).
Porphyromonas gingivalis Induces Apoptosis and Autophagy via ER Stress in Human Umbilical Vein Endothelial Cells
Muller et al., "Expression and function of C/EBP homology protein (GADD153) in podocytes," The American Journal of Pathology, vol.
Diabetes-Induced Reactive Oxygen Species: Mechanism of Their Generation and Role in Renal Injury
Holbrook, "Physical and functional association between GADD153 And CCAAT/enhancer-binding protein during cellular stress," The Journal of Biological Chemistry, vol.
Cellular Homeostasis and Antioxidant Response in Epithelial HT29 Cells on Titania Nanotube Arrays Surface
Holbrook, "Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bc12 and perturbing the cellular redox state," Molecular and Cellular Biology, vol.
Tang-Luo-Ning, a Traditional Chinese Medicine, Inhibits Endoplasmic Reticulum Stress-Induced Apoptosis of Schwann Cells under High Glucose Environment
These studies suggested that preventive mitochondrial protection might delay the onset of POAG in patients carrying the MYOC mutation, P370L.[sup][4] CHOP (also called GADD153 or DDIT3 ) encodes a member of the CCAAT/enhancer-binding proteins, which is a family of transcription factors.[sup][5] The CHOP protein is activated by endoplasmic reticulum (ER) stress and the mitochondrial unfolded protein response and can promote apoptosis.
Idebenone Maintains Survival of Mutant Myocilin Cells by Inhibiting Apoptosis
DDIT3, also known as GADD153 or CHOP, encodes a transcription factor belonging to the C/EBP family.
Study of molecular mechanisms of PDLIM4/RIL in promotion of the development of breast cancer
Increased GADD153 gene expression during iron chelation-induced apoptosis in Jurkat T-lymphocytes.
Modulation of iron metabolism by iron chelation regulates intracellular calcium and increases sensitivity to doxorubicin
Oxidative stress in the endoplasmic reticulum activates protein transcription factor Gadd153, a protein that sensitizes cells to endoplasmic reticulum stress and produces reactive oxygen species through setting up.
The effects of caffeine supplements on exercise-induced oxidative damages
Habener, "Transcription factors C/EBPa, C/EBP^, and CHOP (Gadd153) expressed during the differentiation program of keratinocytes in vitro and in vivo," Journal of Investigative Dermatology, vol.
Inductive and deductive approaches to acute cell injury
Gulbins, "Fas- or ceramide-induced apoptosis is mediated by a Rac1-regulated activation of Jun N-terminal kinase/p38 kinases and GADD153," Journal of Biological Chemistry, vol.
P104 binds to Rac1 and reduces its activity during myotube differentiation of C2C12 cell

Medical browser ?
Full browser ?