(redirected from FSH-R)


A gene on chromosome 2p21-p16 that encodes a G protein-coupled receptor for follicle stimulating hormone, which plays a key role in gonad development.

Molecular pathology
FSHR mutations cause ovarian dysgenesis type 1 and ovarian hyperstimulation syndrome.
References in periodicals archive ?
Secondly, to investigate their effects on the expression of developmental genes including PCNA, BMPR-IB, BMPR-II, FSH-R, CYP17 and ZP3 by real-time RT-PCR.
Real-time RT-PCR: Evaluation of PCNA, BMPR-IB, BMPR-II, FSH-R, CYP17 and ZP3 mRNA in two cultured groups including [FSH.sup.+]/[BMP15.sup.+] and [FSH.sup.+]/[BMP15.sup.-] (which has higher percentage of growing follicles) and non-cultured ovaries as control (14 and 21 day mouse ovaries) were done by real-time RT-PCR (at least 3 repeats).
The mRNA level of PCNA, BMPR-IB, BMPR-U, FSH-R, CYP17 and ZP3 in ovaries was quantified using the ABI 7500 Sequence Detector (Applied Biosystems, UK) according to the manufacturer's instructions.
Real time RT-PCR analysis: The relative expression of PCNA, BMPR-IB, BMPR-II, FSH-R, CYP17 and ZP3 genes compared with the house-keeping gene (GAPDH) in all groups is shown in figure 3.
Other parts of our molecular results showed BMP15 and FSH supplementation down-regulated the expression of BMPR-IB, BMPR-II and FSH-R in cultured mouse ovaries.
FSH receptors are expressed in goat ovarian follicles at different stages of development, but it is unknown if activin-A up-regulates FSH-R expression during growth and potentiates FSH action in-vitro.
Moreover, we studied the effects of activin-A and FSH on the growth of secondary follicles, and the influence of activin-A and FSH on the levels of mRNA for FSH-R and inhibinBA subunit in 6-days cultured secondary follicles.
The primers were designed to perform amplification of mRNA for inhibin BA (sense [s]: atatcggagaaggtggtggatgct; antisense [as]: actgctcacaggcaatccgtatgt), FSH-R (s: aggcaaatgtgttctccaacctgc; as: tggaaggcatcagggtcgatgtat), and housekeeping genes [beta]-Actin (s: accactggcattgtcatggactct; as: tccttgatgtcacggacgatttcc), ubiquitin (s: gaagatggccgcactcttctgat; as: atcctggatcttggccttcacgtt) and [beta]-tubulin (s: ttcattggcaa cagcacagcca; as: tcgttcatgttgctctcagcct).
To evaluate the effect of activin-A, FSH and their combination on the expression of the mRNA for FSH-R and inhibin-[beta]A subunit in cultured goat follicles, respectively, for each treatment, three groups of eight follicles were collected at the end of the 6-day culture period and then stored at -80[degrees]C until extraction of total RNA.
The nonparametric Kruskal-Wallis test was used to compare data of mRNA for inhibin-[beta]A subunit in uncultured primordial, primary and secondary follicles, and the levels of mRNA for inhibin-[beta]A subunit and FSH-R in cultured follicles.
In-vitro growth of caprine follicles and expression of inhibin-[beta]A subunit and FSH-R