FGF7


Also found in: Dictionary, Acronyms, Encyclopedia.

FGF7

A gene on chromosome 15q21.2 that encodes fibroblast growth factor 7 of the FGF family, which bind heparin and have a broad range of cellular activities, including cell survival, division, differentiation and migration, embryonic development, morphogenesis, tissue repair, tumour growth and invasion. FGF7 is a potent epithelial cell-specific growth factor, which is mitogenic for keratinocytes, but has little effect on fibroblasts; it is required for normal branching morphogenesis. FGF7 interacts with FGF2 receptor (FGFR2).
References in periodicals archive ?
[6] Human genes: FGF2, fibroblast growth factor 2 (basic); FGF1, fibroblast growth factor 1 (acidic); FGF7, fibroblast growth factor 7; FGFR1, fibroblast growth factor receptor1; FGF18, fibroblast growth factor 18; FGF23, fibroblast growth factor 23; FGF5, fibroblast growth factor 5; FGFR2, fibroblast growth factor receptor 2; FGFR4, fibroblast growth factor receptor 4; FGF14, fibroblast growth factor 14; FGF9, fibroblast growth factor 9; FGF10, fibroblast growth factor 10.
Gene Forward (5 -3) Reverse (5-3) Egr1 AACAACCCTACGAGCACCTG AAAGGGGTTCAGGCCACAAA Fgf2 GCGACCCACACGTCAAACTA CCGTGACCGGTAAGTGTTGTA Fgf7 TGTGGCAATCAAAGGGGTGG AAGGCCACGAACATTTCCCC Jak2 AGTGTGCTACAGTGCTGGTC TTCCTTGTTGCCAGATCCCG Mmp9 GCCGGGAACGTATCTGGAAA GGTTGTGGAAACTCACACGC Notch2 AACTGCACCTCCTCACTTCG CTCCTCGTTGTTGCATCCCT Vim CATGCGGCTGCGAGAAAAAT GGTCAAGACGTGCCAGAGAA Zeb2 AAAGCAGTTCCCTTCTGCGA AGGAGCCCGAGTGTGAAAAG Hif1[alpha] CTCATCCAAGGAGCCTTAACCT TAACGTTCCAATTCCTGCTGC Lox AGGGCGGATGTCAGAGACTA CATCCAGCAGGTCGTAGTGG Cdh1 CCACCAGATGACGATACCCG GAATCACTTCCGGTCTGGCA Table 2: miRNA specific TaqMan microRNA assays.
Moreover, Fgf3, Fgf7, Fgf10, Fgf16, Fgf18, and Fgf21 are also detected in the incisor [65].
In addition, Fgf7 transcripts have been detected in the developing bone surrounding the tooth germ [63].
Nonetheless, osteopontin, fibroblast growth factor 6 (FGF6), fibroblast growth factor 7 (FGF7), neurotrophin 3 (NT-3), insulin-like growth factor-binding protein 4 (IGFBP4), and tissue inhibitor of metalloproteinases 2 (TIMP2) levels were significantly upregulated in CG-N-conditioned media compared to CG-P-conditioned media (Figure 4(b)).
Despite the fundamental homeostatic roles of FGF family isoforms, such as FGF2, in the heart [48, 49], to the best of our knowledge, many other members of the FGF family, including FGF6 and FGF7, have not been directly associated with any cardiac condition.
The majority of these secretome components (EGF, IGF1, FGF2 [26, 27, 33], FGF7 (or KGF) [28], IL-6 [34], ALDH3 [24], or EDA activators [25]) have similar cellular downstream effects such as the reduction in cell apoptosis and/or the promotion of epithelial proliferation.
The DP is a specialized niche compartment, and their signals (such as TGFB2 and FGF7) have a strong influence in regulating TAC proliferation, migration, and differentiation.