KAT5

(redirected from ESA1)

KAT5

A gene on chromosome 11q13 that encodes a catalytic subunit of the NuA4 histone acetyltransferase complex (NuA4 HAC) involved in transcriptional activation of genes, principally by acetylating nucleosomal histones H4 and H2A. The NuA4 HAC may be required for activating transcription programmes of oncogene and proto-oncogene mediated growth induction, tumour suppressor-mediated growth arrest/replicative senescence, apoptosis, and DNA repair. Post-translational modifications include sumoylation, phosphorylation, ubiquination and autoacetylation.
References in periodicals archive ?
(2008) Catalytic-site mutations in the MYST family histone Acetyltransferase Esa1. Genetics 178, 1209-1220.
ESA in humans increased from L1 to L 5, in both upper (713.7 [+ or -] 89.6 [mm.sup.2] at L1 to 931.1 [+ or -] 243.6 [mm.sup.2] at L5) and lower (814.2 [+ or -] 100.2 [mm.sup.2] at LI to 997.2 [+ or -] 106.5 [mm.sup.2] at L5) levels, and the upper ESA (ESAu) was less than the lower ESA (ESA1).
Similar observations are reported for the different families of HATs such as p300 [66], Rtt109 [67], PCAF [68], and ESA1 [69] wherein the autoacetylated ESA1 was alone reported to be a stable intermediate as reported above.
Marmorstein, "The catalytic mechanism of the ESA1 histone acetyltransferase involves a self-acetylated intermediate," Nature Structural Biology, vol.
The first, designated as ESA1 for these trials, forms fluxing agents at elevated temperatures but is relatively neutral at ambient temperatures.
Bulk Density and Loss On Ignition of the Additives Alone, and pH and ADV of Mixes of the Additives and Wedron 540 Sand Mix Density % LOI pH ADV @ pH 5 ADV @ pH 7 g/100ml Wedron 540 160 0.07 7.8 0.1 0.0 with 1% woodflour 30 89.6 5.5 1.8 1.1 with 1% RIO 140 1.63 6.8 3.1 2.7 with 1% starch 58 95.2 7.0 2.8 2.2 with 2% BIO 215 -2.7 7.0 4.3 3.8 with 2.5% ESA1 175 37.5 9.4 18.6 17.9 with 4% ESA2 118 3.5 9.8 2.7 2.3 with 6% ESA3 42 4.4 11.3 42.2 41.6 with 6% old ESA 142 0.3 8.4 3.2 2.8 The woodflour, starch and iron oxides tended to drive the pH down (more acidic) and the engineered sand additives tended to increase the pH and ADV.
The ESA1 and ESA2 showed the least loss of strength.
BCIRA Test Results for the Different Additives on NA Sand Binder Sand Mix Max Deflection Time to Max Time to Zero Time to Deflection Failure No additive 0.303 13.3 24.0 132.7 1% Woodflour 0.197 8.7 18.3 70.7 1% RIO 0.363 14.0 28.0 151.7 1% starch 0.123 5.3 15.7 60.7 2% BIO 0.247 12.3 32.7 193.7 2.5% ESA1 0.290 15.0 31.0 190.0 4% ESA2 0.333 17.0 30.7 201.3 6% ESA3 0.267 16.3 32.0 151.7 6% old ESA 0.327 13.0 25.3 103.0 BCIRA results were mixed.
Padronizou-se PCR uniplex para cada gene de EE e, para amplificacao dos fragmentos de sea, seb, sec e sed, cada reacao consistiu de 10pmol de cada um dos oligonu cleotideos ESA1 e 2, ESB1 e 2, SEC1 e 2 e SED1 e 2, solucao tampao para PCR contendo 1,25mM de KCl e 0,5mM de Tris-HCl (pH 8,4), 5mM de cloreto de magnesio, 218[micro]M de dNTPs mix, 1,5U de Taq DNA polimerase, 10 a 100ng de DNA e agua ultra pura esterilizada totalizando 40[micro]L de volume final.
Na primeira PCRm utilizou-se 250mM de cada um dos primers ESA1 e 2, ESB1 e 2, femA1 e femA2, solucao tampao para PCR, 5mM de cloreto de magnesio, 218[micron]M de dNTPs mix, 1,5U de Taq DNA polimerase e 1[micron]l do DNA alvo (10-20ng*[micron][l.sup.-1]) em 40[micron]l de volume final.
aureus ENTEROTOXIGENICOS E RESPECTIVOS PRODUTOS DE AMPLIFICACAO Primers Sequencia 5' [right arrow] 3' Posicao Produto de no gene amplificacao (pb) ESA1 ACGATCAATTTTTACAGC 203 a 222 544 ESA2 TGCATGTTTTCAGAGTTAATC 726 a 746 ESB1 GAATGATATTAATTCGCATC 621 a 640 416 ESB2 TCTTTGTCGTAAGATAAACTTC 1015 a 1036 SEC1 GACATAAAAGCTAGGAATTT 676 a 695 257 SEC2 AAATCGGATTAACATTATCCA 912 a 932 SED1 CAAATATATTGATATAATGA 4 a 23 330 SED2 AGTAAAAAAGAGTAATGCAA 314 a 333 femA1 AAAAAAGCACATAACAAGCG 1444 a 1463 132 femA2 GATAAAGAAGAAACCAGCAG 1556 a 1575 Primers Referencia ESA1 Rosec e Gigaud (2002) ESA2 ESB1 Rosec e Gigaad (2002) ESB2 SEC1 Najera-Sanchez et al.