MAPK3

(redirected from ERK1)
Also found in: Acronyms.

MAPK3

A gene on chromosome 16p11.2 that encodes a protein of the MAP kinase family. MAP kinases (e.g., extracellular signal-regulated kinases) integrate multiple biochemical signals and are involved in cell proliferation, differentiation, transcription, regulation and development. Once MAPK3 is activated by phosphorylation by an upstream kinase, it translocates to the nucleus of the stimulated cell, where it phosphorylates target molecules.
References in periodicals archive ?
Herbal formula HMC05 prevents human aortic smooth muscle cell migration and proliferation by inhibiting the ERK1 /2 MAPK signaling cascade.
Primer sequences (5' to 3') ZO-1 ZO-1-f GACTTAAAGCTGCCTCAACA ZO-1-r GGTTTGTTTCAGGCGAAAGT Claudin-1 Claudin-1-f TTCTGGGAGGTGCCCTACTT Claudin-1-r TGGATAGGGCCTTGGTGTTG Occludin Occludin-f CCATGGCCTACTACTCGTCC Occludin-r CGGCACCGGTGTTGATTTAT ERK1 ERK1-f TGCATTCTGGCTGAGATGCT ERK1-r TGAGCTGGTCCAGGTAGTGC ERK2 ERK2-f CCGTGACCTCAAACCTTCCA ERK2-r CCAACCCAAAGTCACAGATC p90RSK p90RSK-f ACCTGGTGTCAAAGATGCTTC p90RSK-r CAGTGGACGATCCAAGGATGT TCGGAAGTGTGTATCCCGTAGG GCAAGGAACACGGCTAAGTTG Gene Annealing GenBank temperature accession no.
The proteins, called ERK1 and ERK2, appear to bring about the maturation and release of the egg.
ERK1 and ERK2 are a critical nexus between the surge in luteinizing hormone and ovulation, said Dr Louis V.
Based on the present results it can be hypothesized that inhibition of LPS-activated ERK1 /2 and downstream signaling could partly account for this observation.
Meanwhile, MAPK signaling pathway molecules including MEKK1, ASK1 (MAP3K5), MLK2 (MAP3K10), MLK3, NIK, MEK1 (MAP2K1), MEK2 (MAP2K2), MEK4 (MAP2K4), MEK7 (MAP2K7), ERK1 (MAPK3), JNK1 (MAPK8) and JNK2 (MAPK9) were significantly up-regulated and revealed 2.
Interestingly, ERK1/2 phosphorylation by BPA was abolished by silencing GPER expression (Figures 1D, 2C), suggesting that GPER is required for ERK1 /2 activation after exposure to BPA.
In the current study, a rat pituitary cancer cell line was used to study the effect of alkylphenols and BPA on ERK1 and ERK2 activation (measured as phosphorylation), both alone and in combination with each physiologic estrogen.
In addition, extracellular signal-regulated kinases ERK1 and ERK2 were completely inactivated, whereas p38 was found activated in human leukemia U937 cells treated with arsenic trioxide ([As.