EREG


Also found in: Dictionary, Thesaurus, Financial, Acronyms, Encyclopedia.

EREG

A gene on chromosome 4q13.3 that encodes epiregulin, a member of the epidermal growth family, which is a ligand of the EGF receptor (EGFR) and ERBB4 and may mediate localised cell proliferation. It may also stimulate cell proliferation and/or angiogenesis.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
As sequencias dos primers para Ereg (iniciador sense: ACTGCACAGCATTAGTTCAAACTGA; iniciador anti-sense: TGTCCATGCAAACAGTAGCCATT) e ciclofilina (SANTOS et al., 2011) foram obtidas utilizando Primer Express Software v3.0 (Applied Biosystems, USA) e sintetizados pela Invitrogen.
At PND49, fat pad length and ductal elongation were also unchanged by HFD and maternal TCDD exposure, and at PND50, we found no treatment-associated changes in expression of mammary morphology regulators Egf and Ereg (data not shown).
Instead, we used the more conservative generalized linear model (Proc GLM; SAS Institute Inc.) to evaluate the effect of TCDD, DMBA, and diet on phenotypes (body weight, percent body fat, fasting blood glucose, branch elongation, fat pad length, number of terminal end buds, size of terminal end buds, and fold change) (Livak and Schmittgen 2001) of Cyp1a1, Cyp1a2, Cyp1b1, Areg, Ereg, Egf, Rac1, Tgfb, Bax, Ccnd1, Mki67, Igf1, Fgf2, Ahr, Egfr, and Esr1 levels.