A gene on chromosome 3q11.2 that encodes a member of the ephrin-A receptor subfamily of receptor tyrosine kinases, which “promiscuously” bind membrane-bound ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signalling into neighbouring cells. EPNA6 is expressed in the brain and testes.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
Xie et al., "EphA6 promotes angiogenesis and prostate cancer metastasis and is associated with human prostate cancer progression," Oncotarget, vol.
Symbol Entrez gene name WNT16 Wingless-type MMTV integration site family, member 16 PLCD4 Phospholipase C, delta 4 ADAM29 ADAM metallopeptidase domain 29 MMP8 Matrix metallopeptidase 8 (neutrophil collagenase) EPHA6 EPH receptor A6 PAK7 p21 protein (Cdc42/Rac)-activated kinase 7 EPHA7 EPH receptor A7 EPHA3 EPH receptor A3 SEMA6D Serna domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D ADAM30 ADAM metallopeptidase domain 30 UNC5D Unc-5 homolog D (C.
The gene expression of the following molecules was analyzed: the neurotrophic factors NT-3 (Rn00579280_ml), GDNF (Rn00569510_ml), BDNF (customized, Forward 5'TGGTTATTTCATACTTCGGTTGCATGA3', Reverse 5'TGTCCGTGGACGTTTGCTT3', and Probe 5'CTGCGCCCATGAAAG3'), and FGF-2 (Rn00570809_ml), the Eph receptors EphA6 (Rn01474859_ml) and EphB2 (Rn01181017_ml), and the small GTPase RhoA (Rn04219610_gl).
Finally, the relative gene expression analyses of EphA6 and EphB2 receptors as well as the small GTPase RhoA, performed by RT-PCR in an adjacent region, showed no differences among the experimental groups (Table 2).
The EphA6 and EphB2 signals that were not shown by western blot and immunohistochemistry were evaluated at molecular levels by employing RT-PCR.
Although some Eph receptors were rather widely expressed, we observed some remarkable restrictions: the EphA6, EphB1, and EphA8 genes were preferentially highly expressed in brain and testis.
In the colon carcinomas, EphA6, -A7, and -B1 were down-regulated; EphA6 expression was 94-fold lower than in the healthy colon tissue.
Another peculiar profile was found in brain and testis, in which EphA6, EphA8, and EphB1 are relatively highly expressed.
A set of Eph/ephrin members for which expression was up- or down-regulated more than fivefold in carcinomas compared with healthy tissue were identified in this study (e.g., ephrin-A3 in lung carcinoma, EphB2 in hepatocellular carcinoma, and EphA6 in renal cell carcinoma).