A gene on chromosome 3p26.1 that encodes an enzyme directly involved in endoplasmic reticulum-associated degradation (ERAD), extracting misfolded—but not productively folded—glycoproteins from the calnexin cycle and targeting them for degradation in an N-glycan-independent manner, probably by forming a complex with SEL1L. It interacts with DERL2 and DERL3.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
It was initially assumed that UPRE was located in the promoter of ERAD genes such as E3 ubiquitin-protein ligase synoviolin (HRD1) and ER degradation enhancing alphamannosidase-like protein 1 (EDEM1) [15,16].
Additionally, as the transcriptional regulation of BiP, GRP94, HRD1, and EDEM1 depends on the duration of heat stress, we can confirm that the refolding and degradation of unfolded and misfolded proteins is stress-and/or time-dependent.
In this study, we located the UPRE sequence in horse SLC25A but not in ERAD genes such as HRD1 and EDEM1. Therefore, it is likely that other ER-stress-related elements may compensate for the absence of UPRE in horse ERAD genes or perhaps a novel and unique mechanism exists.
Although horse HRD1 and EDEM1 do not contain UPRE, their expression was not altered to the same degree as BiP and GRP94, suggesting that 4 h of heat shock is not a sufficient duration to induce the ERAD system (Figure 4C).
We investigated the levels of mRNAs, DNA damage inducible transcript 3 (chop), growth arrest, and DNA damage-inducible, [alpha], a (gadd45[alpha]a) and endoplasmic reticulum degradation-enhancing [alpha]-mannosidase-like protein 1 (edem1), which were related to endoplasmic reticulum stress and DNA damage [22-24].
In another aspect, edem1, a gene essential for the unfolded protein response, was upregulated markedly with endoplasmic reticulum stress unbalance [24].
Gene FP sequence (5'-3') RP sequence (5'-3') cyp2y3 tattcccatgctgcactctg aggagcgtttacctgcagaa cyp3a65 aaaccctgatgagcatggac caagtctttggggatgagga hmgcra ctgaggctctggtggacgtg gatagcagctacgatgttggcg hmgcrb cctgttagccgtcagtgga tctttgaccactcgtgccg hmgcs ctcactcgtgtggacgagaa gatacggggcatcttcttga fasn gagaaagcttgccaaacagg gagggtcttgcaggagacag fads2 tcatcgtcgctgttattctgg tgaagatgttgggtttagcgtg chop aggaaagtgcaggagctgac ctccacaagaagaatttcctcc gadd45[alpha]a tggctttgtttgtgggactt tggaaaacagtccactgaga edem1 gacagcagaaaccctcaagc catggccctcatcttgactt rpp0 ctgaacatctcgcccttctc tagccgatctgcagacacac Table 2: Hesperidin treatment improved alcohol metabolism in zebrafish larvae.
Expression of XBP1 and EDEM1 suggested induction of ERAD pathway, which in turn stimulates ER chaperones.
When HeLa cells were subjected to ER stress for 14, 24 and 42 h, most of the chaperones, including CNX, calreticulin, BiP, EDEM1, FBG3, ERGIC-53, MCFD2, and VIP36, were increased by more than 5-fold 24 h after the induction of ER stress.
When trimming of an outermost Man residue occurs on the C-arm of high mannose-type glycans by EDEM1 or EDEM3, it binds OS-9 and XTP3-B.
(2010) EDEM1 accelerates the trimming of [alpha]1,2-linked mannose on the C branch of N-glycans.
We also found a gene (EDEM1, ER degradation enhancer, mannosidase alpha-like 1) related to the adipogenesis.